FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638119_at:

>probe:Drosophila_2:1638119_at:369:711; Interrogation_Position=1065; Antisense; TTCATGAAAGAACTCCCGACGGCAG
>probe:Drosophila_2:1638119_at:721:103; Interrogation_Position=1088; Antisense; AGACGCCTTGAATATGTGCCGCAAT
>probe:Drosophila_2:1638119_at:515:303; Interrogation_Position=1121; Antisense; CCGCGGCGTTGAGGATGGTCACATA
>probe:Drosophila_2:1638119_at:591:537; Interrogation_Position=1137; Antisense; GGTCACATATCCACCGACTATAGAT
>probe:Drosophila_2:1638119_at:224:677; Interrogation_Position=1157; Antisense; TAGATTAATTTGTCACTGCCAGTGC
>probe:Drosophila_2:1638119_at:217:283; Interrogation_Position=1172; Antisense; CTGCCAGTGCAATTCGACGGAGAGT
>probe:Drosophila_2:1638119_at:226:437; Interrogation_Position=1215; Antisense; GAGGAGATACAGACATGGCCCCACT
>probe:Drosophila_2:1638119_at:315:69; Interrogation_Position=1229; Antisense; ATGGCCCCACTTTTACAATATCGAG
>probe:Drosophila_2:1638119_at:231:401; Interrogation_Position=1302; Antisense; GACTTAAATGCACCCGAGTTACGTT
>probe:Drosophila_2:1638119_at:345:625; Interrogation_Position=808; Antisense; TGCCCTTGCAACTGCCTGTTAAATA
>probe:Drosophila_2:1638119_at:21:403; Interrogation_Position=889; Antisense; GACTTATCCGTGACATGCAGTGCTT
>probe:Drosophila_2:1638119_at:363:263; Interrogation_Position=906; Antisense; CAGTGCTTCCACATTGAGTCGCGGG
>probe:Drosophila_2:1638119_at:570:55; Interrogation_Position=937; Antisense; ATGACATTGCGTACAACTTCCTGGT
>probe:Drosophila_2:1638119_at:572:589; Interrogation_Position=958; Antisense; TGGTCGGCTGCGATGGCAACATCTA

Paste this into a BLAST search page for me
TTCATGAAAGAACTCCCGACGGCAGAGACGCCTTGAATATGTGCCGCAATCCGCGGCGTTGAGGATGGTCACATAGGTCACATATCCACCGACTATAGATTAGATTAATTTGTCACTGCCAGTGCCTGCCAGTGCAATTCGACGGAGAGTGAGGAGATACAGACATGGCCCCACTATGGCCCCACTTTTACAATATCGAGGACTTAAATGCACCCGAGTTACGTTTGCCCTTGCAACTGCCTGTTAAATAGACTTATCCGTGACATGCAGTGCTTCAGTGCTTCCACATTGAGTCGCGGGATGACATTGCGTACAACTTCCTGGTTGGTCGGCTGCGATGGCAACATCTA

Full Affymetrix probeset data:

Annotations for 1638119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720