FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638120_at:

>probe:Drosophila_2:1638120_at:654:399; Interrogation_Position=1014; Antisense; GACAGCAAGTACAACCGCATCTTCG
>probe:Drosophila_2:1638120_at:51:303; Interrogation_Position=1028; Antisense; CCGCATCTTCGATATCCTTAACAAG
>probe:Drosophila_2:1638120_at:648:151; Interrogation_Position=1067; Antisense; ACATCGCTCCGAGGCGCTGAAGGAC
>probe:Drosophila_2:1638120_at:32:257; Interrogation_Position=1154; Antisense; CAAATGTTTTTGTCACACGGTCAAC
>probe:Drosophila_2:1638120_at:76:365; Interrogation_Position=617; Antisense; GAATTTCCATGTACCCAAGCACTAT
>probe:Drosophila_2:1638120_at:666:683; Interrogation_Position=639; Antisense; TATCTCCGCGGAACCATATGCGATG
>probe:Drosophila_2:1638120_at:648:295; Interrogation_Position=674; Antisense; CGAGCTGGCCAATACGGTGAGATAT
>probe:Drosophila_2:1638120_at:535:571; Interrogation_Position=747; Antisense; GGCTACGAACGCGAGGACTATTGTC
>probe:Drosophila_2:1638120_at:354:575; Interrogation_Position=780; Antisense; GGCGTGAGCAACAACATAATCCTGG
>probe:Drosophila_2:1638120_at:282:665; Interrogation_Position=855; Antisense; TACAACTTCGTCATTGGAGCCACGC
>probe:Drosophila_2:1638120_at:593:41; Interrogation_Position=888; Antisense; ATCGAGATCGTCCTGCACATGATGT
>probe:Drosophila_2:1638120_at:446:151; Interrogation_Position=904; Antisense; ACATGATGTCCCACCACAGGAACGG
>probe:Drosophila_2:1638120_at:452:153; Interrogation_Position=919; Antisense; ACAGGAACGGTCTCACCATGCAGAA
>probe:Drosophila_2:1638120_at:593:107; Interrogation_Position=940; Antisense; AGAAGAGCCTGTACTTCCGTAGTCC

Paste this into a BLAST search page for me
GACAGCAAGTACAACCGCATCTTCGCCGCATCTTCGATATCCTTAACAAGACATCGCTCCGAGGCGCTGAAGGACCAAATGTTTTTGTCACACGGTCAACGAATTTCCATGTACCCAAGCACTATTATCTCCGCGGAACCATATGCGATGCGAGCTGGCCAATACGGTGAGATATGGCTACGAACGCGAGGACTATTGTCGGCGTGAGCAACAACATAATCCTGGTACAACTTCGTCATTGGAGCCACGCATCGAGATCGTCCTGCACATGATGTACATGATGTCCCACCACAGGAACGGACAGGAACGGTCTCACCATGCAGAAAGAAGAGCCTGTACTTCCGTAGTCC

Full Affymetrix probeset data:

Annotations for 1638120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720