Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638121_at:

>probe:Drosophila_2:1638121_at:407:311; Interrogation_Position=1022; Antisense; GCCACACAGGGCATACCGGAGGACA
>probe:Drosophila_2:1638121_at:342:153; Interrogation_Position=1044; Antisense; ACATGATGGGTCTGGACCACGGCCA
>probe:Drosophila_2:1638121_at:214:267; Interrogation_Position=1075; Antisense; CAGTCAGATGTTTGCTGGCGCTATT
>probe:Drosophila_2:1638121_at:42:333; Interrogation_Position=1088; Antisense; GCTGGCGCTATTTGTGCATCCAAAA
>probe:Drosophila_2:1638121_at:636:129; Interrogation_Position=1129; Antisense; ACCGCCAGGCTTGTTCGAAAACGAG
>probe:Drosophila_2:1638121_at:308:419; Interrogation_Position=1151; Antisense; GAGCTATTCTCCAAAGGCACCGAGT
>probe:Drosophila_2:1638121_at:567:169; Interrogation_Position=1163; Antisense; AAAGGCACCGAGTCCATGCTGGAGG
>probe:Drosophila_2:1638121_at:123:29; Interrogation_Position=1239; Antisense; ATACGGCCACCGCTTGCTTGAAGTT
>probe:Drosophila_2:1638121_at:201:71; Interrogation_Position=1267; Antisense; AGGCGCCGACAAGGTCTCGCATGTG
>probe:Drosophila_2:1638121_at:346:223; Interrogation_Position=1331; Antisense; AAGGTTCTGCCTGGAGTGGCTGCTC
>probe:Drosophila_2:1638121_at:356:521; Interrogation_Position=1346; Antisense; GTGGCTGCTCTTTCGGATGCCTAAA
>probe:Drosophila_2:1638121_at:345:447; Interrogation_Position=1361; Antisense; GATGCCTAAACGCACTGCTTTACAA
>probe:Drosophila_2:1638121_at:525:707; Interrogation_Position=870; Antisense; TTGGAAAGTCCCTCTTCGACGAGAA
>probe:Drosophila_2:1638121_at:163:669; Interrogation_Position=951; Antisense; TACTATTTCCGATTGACTTTGTCAT

Paste this into a BLAST search page for me
GCCACACAGGGCATACCGGAGGACAACATGATGGGTCTGGACCACGGCCACAGTCAGATGTTTGCTGGCGCTATTGCTGGCGCTATTTGTGCATCCAAAAACCGCCAGGCTTGTTCGAAAACGAGGAGCTATTCTCCAAAGGCACCGAGTAAAGGCACCGAGTCCATGCTGGAGGATACGGCCACCGCTTGCTTGAAGTTAGGCGCCGACAAGGTCTCGCATGTGAAGGTTCTGCCTGGAGTGGCTGCTCGTGGCTGCTCTTTCGGATGCCTAAAGATGCCTAAACGCACTGCTTTACAATTGGAAAGTCCCTCTTCGACGAGAATACTATTTCCGATTGACTTTGTCAT

Full Affymetrix probeset data:

Annotations for 1638121_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime