Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638122_a_at:

>probe:Drosophila_2:1638122_a_at:569:155; Interrogation_Position=151; Antisense; ACAGAAGCTGGTGAACGACGTGGAA
>probe:Drosophila_2:1638122_a_at:641:437; Interrogation_Position=182; Antisense; GAGGAAGCCCAAAGCGCACCGAAAT
>probe:Drosophila_2:1638122_a_at:444:295; Interrogation_Position=20; Antisense; CGAAGTGCGATAGGCCCCGATAGTT
>probe:Drosophila_2:1638122_a_at:222:301; Interrogation_Position=224; Antisense; CCCGCCGTTCCGAATATCAAAATCA
>probe:Drosophila_2:1638122_a_at:679:169; Interrogation_Position=248; Antisense; AAAGGCATATCCAGCGGCGAGACCA
>probe:Drosophila_2:1638122_a_at:359:423; Interrogation_Position=266; Antisense; GAGACCACTCGCAGCAGAAACTCGG
>probe:Drosophila_2:1638122_a_at:243:631; Interrogation_Position=293; Antisense; TCCTGCTCCATCGAGAGGACGATAT
>probe:Drosophila_2:1638122_a_at:142:83; Interrogation_Position=342; Antisense; AGGGCCAGGGTCAAGCGGCCACCAA
>probe:Drosophila_2:1638122_a_at:502:413; Interrogation_Position=370; Antisense; GACCTATGTGAATGAGCGCCGGCCA
>probe:Drosophila_2:1638122_a_at:193:215; Interrogation_Position=439; Antisense; AAGATTCGAGTTCAAGACCCGGCCG
>probe:Drosophila_2:1638122_a_at:513:151; Interrogation_Position=499; Antisense; ACATGGAAAGAGCTCTCCTCGGACT
>probe:Drosophila_2:1638122_a_at:235:639; Interrogation_Position=517; Antisense; TCGGACTGCTGGACGACTTTCACTC
>probe:Drosophila_2:1638122_a_at:93:277; Interrogation_Position=533; Antisense; CTTTCACTCCGGCAAGCTGAGGGCA
>probe:Drosophila_2:1638122_a_at:614:705; Interrogation_Position=78; Antisense; TTCTTGACCGAATTTAGCGTAATCT

Paste this into a BLAST search page for me
ACAGAAGCTGGTGAACGACGTGGAAGAGGAAGCCCAAAGCGCACCGAAATCGAAGTGCGATAGGCCCCGATAGTTCCCGCCGTTCCGAATATCAAAATCAAAAGGCATATCCAGCGGCGAGACCAGAGACCACTCGCAGCAGAAACTCGGTCCTGCTCCATCGAGAGGACGATATAGGGCCAGGGTCAAGCGGCCACCAAGACCTATGTGAATGAGCGCCGGCCAAAGATTCGAGTTCAAGACCCGGCCGACATGGAAAGAGCTCTCCTCGGACTTCGGACTGCTGGACGACTTTCACTCCTTTCACTCCGGCAAGCTGAGGGCATTCTTGACCGAATTTAGCGTAATCT

Full Affymetrix probeset data:

Annotations for 1638122_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime