Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638123_at:

>probe:Drosophila_2:1638123_at:571:527; Interrogation_Position=1623; Antisense; GGGACTCAGCAATGTGACGTTATCT
>probe:Drosophila_2:1638123_at:712:501; Interrogation_Position=1661; Antisense; GTCGCTTTCGTAAATGGCGGCGCAC
>probe:Drosophila_2:1638123_at:493:145; Interrogation_Position=1707; Antisense; ACTCCACCCCAACGTACATATATGT
>probe:Drosophila_2:1638123_at:546:23; Interrogation_Position=1773; Antisense; ATATGCACATCCACTCTCTGATATT
>probe:Drosophila_2:1638123_at:208:279; Interrogation_Position=1786; Antisense; CTCTCTGATATTTTATTCTCGCCTG
>probe:Drosophila_2:1638123_at:604:685; Interrogation_Position=1799; Antisense; TATTCTCGCCTGTAATTGCTTAATT
>probe:Drosophila_2:1638123_at:506:713; Interrogation_Position=1814; Antisense; TTGCTTAATTCTAGAGTGGCTCTGC
>probe:Drosophila_2:1638123_at:600:581; Interrogation_Position=1830; Antisense; TGGCTCTGCGTAGAGGACATCCACT
>probe:Drosophila_2:1638123_at:380:401; Interrogation_Position=1845; Antisense; GACATCCACTTTACATATCTCCTAA
>probe:Drosophila_2:1638123_at:452:515; Interrogation_Position=1901; Antisense; GTGTATCTGTATGTATTCCCTTATT
>probe:Drosophila_2:1638123_at:686:665; Interrogation_Position=1985; Antisense; TACACATTGAGTACCTACCTATAAG
>probe:Drosophila_2:1638123_at:491:667; Interrogation_Position=2012; Antisense; TACTTTTTTCGAATAGCTGTCCCTT
>probe:Drosophila_2:1638123_at:519:597; Interrogation_Position=2029; Antisense; TGTCCCTTTTCCATTATTCTCTAAT
>probe:Drosophila_2:1638123_at:329:145; Interrogation_Position=2069; Antisense; ACTCTACTGTTCTAATAATTCTCTT

Paste this into a BLAST search page for me
GGGACTCAGCAATGTGACGTTATCTGTCGCTTTCGTAAATGGCGGCGCACACTCCACCCCAACGTACATATATGTATATGCACATCCACTCTCTGATATTCTCTCTGATATTTTATTCTCGCCTGTATTCTCGCCTGTAATTGCTTAATTTTGCTTAATTCTAGAGTGGCTCTGCTGGCTCTGCGTAGAGGACATCCACTGACATCCACTTTACATATCTCCTAAGTGTATCTGTATGTATTCCCTTATTTACACATTGAGTACCTACCTATAAGTACTTTTTTCGAATAGCTGTCCCTTTGTCCCTTTTCCATTATTCTCTAATACTCTACTGTTCTAATAATTCTCTT

Full Affymetrix probeset data:

Annotations for 1638123_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime