FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638124_at:

>probe:Drosophila_2:1638124_at:418:637; Interrogation_Position=1720; Antisense; TCGATGGTTGATTTCCCAGAGCCGA
>probe:Drosophila_2:1638124_at:484:653; Interrogation_Position=1769; Antisense; TTATAACCCCAGCTAATTTGCATAT
>probe:Drosophila_2:1638124_at:646:53; Interrogation_Position=1794; Antisense; ATGCAGGCATACGTACGACCATAGA
>probe:Drosophila_2:1638124_at:531:19; Interrogation_Position=1854; Antisense; ATTTGTTTGACTTTCACACTGCCTG
>probe:Drosophila_2:1638124_at:373:283; Interrogation_Position=1872; Antisense; CTGCCTGATGGCATCGCATCGAAGA
>probe:Drosophila_2:1638124_at:324:677; Interrogation_Position=1938; Antisense; TAGGGCTTTCTGATGGTTTTTAGGC
>probe:Drosophila_2:1638124_at:644:569; Interrogation_Position=1978; Antisense; GGCTAAGTGCCTGACATTTACTAAA
>probe:Drosophila_2:1638124_at:300:221; Interrogation_Position=2008; Antisense; AAGGGAACGGCTTCACAGGCTTTTG
>probe:Drosophila_2:1638124_at:68:693; Interrogation_Position=2029; Antisense; TTTGCTGGTTATACTTTCCCCATTT
>probe:Drosophila_2:1638124_at:31:711; Interrogation_Position=2044; Antisense; TTCCCCATTTGCTCAACCGAAAATT
>probe:Drosophila_2:1638124_at:337:247; Interrogation_Position=2065; Antisense; AATTGCACTTGCCTCGTTAGTCGAA
>probe:Drosophila_2:1638124_at:220:137; Interrogation_Position=2104; Antisense; ACGAGTGGTCGGAATTGCCTCCCAA
>probe:Drosophila_2:1638124_at:624:287; Interrogation_Position=2137; Antisense; CGCCTACTTGGCTTATAACCTTCAA
>probe:Drosophila_2:1638124_at:260:537; Interrogation_Position=2186; Antisense; GGTCATGCCTTTTGGTATCCTTTAA

Paste this into a BLAST search page for me
TCGATGGTTGATTTCCCAGAGCCGATTATAACCCCAGCTAATTTGCATATATGCAGGCATACGTACGACCATAGAATTTGTTTGACTTTCACACTGCCTGCTGCCTGATGGCATCGCATCGAAGATAGGGCTTTCTGATGGTTTTTAGGCGGCTAAGTGCCTGACATTTACTAAAAAGGGAACGGCTTCACAGGCTTTTGTTTGCTGGTTATACTTTCCCCATTTTTCCCCATTTGCTCAACCGAAAATTAATTGCACTTGCCTCGTTAGTCGAAACGAGTGGTCGGAATTGCCTCCCAACGCCTACTTGGCTTATAACCTTCAAGGTCATGCCTTTTGGTATCCTTTAA

Full Affymetrix probeset data:

Annotations for 1638124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720