FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638126_at:

>probe:Drosophila_2:1638126_at:173:695; Interrogation_Position=1054; Antisense; TTTTGAATAACGCTGATTGGCCATC
>probe:Drosophila_2:1638126_at:358:729; Interrogation_Position=1070; Antisense; TTGGCCATCAGGTGTATGCAGATCT
>probe:Drosophila_2:1638126_at:258:59; Interrogation_Position=1139; Antisense; ATGTTTTGTGGCACTCATCTTTCCG
>probe:Drosophila_2:1638126_at:455:719; Interrogation_Position=1159; Antisense; TTCCGCAGTCTTAGCTTTGTATCGA
>probe:Drosophila_2:1638126_at:368:181; Interrogation_Position=1202; Antisense; AAAACATGAAGCCTCTCGACTGCAG
>probe:Drosophila_2:1638126_at:706:617; Interrogation_Position=1222; Antisense; TGCAGGTAACTCAGTAGCCGCGAGA
>probe:Drosophila_2:1638126_at:552:111; Interrogation_Position=676; Antisense; AGCACCCACAGAAGATTTGCCCGAG
>probe:Drosophila_2:1638126_at:490:167; Interrogation_Position=718; Antisense; AAAGGCGACAACCACGACTGCCGTG
>probe:Drosophila_2:1638126_at:18:607; Interrogation_Position=754; Antisense; TGATCCAGACATGAAGCAGCTTTTA
>probe:Drosophila_2:1638126_at:321:353; Interrogation_Position=769; Antisense; GCAGCTTTTATCCTGGTCCAACTAA
>probe:Drosophila_2:1638126_at:173:613; Interrogation_Position=807; Antisense; TGAAATCTCCTTACTGTTCTGAAGA
>probe:Drosophila_2:1638126_at:165:375; Interrogation_Position=827; Antisense; GAAGATACACCCTATCGTTTTTGTT
>probe:Drosophila_2:1638126_at:476:71; Interrogation_Position=918; Antisense; AGGCATTAATTCCTTTGGCAATTCA
>probe:Drosophila_2:1638126_at:293:657; Interrogation_Position=988; Antisense; TAAGCATAGTCAGGCCTCACATGAG

Paste this into a BLAST search page for me
TTTTGAATAACGCTGATTGGCCATCTTGGCCATCAGGTGTATGCAGATCTATGTTTTGTGGCACTCATCTTTCCGTTCCGCAGTCTTAGCTTTGTATCGAAAAACATGAAGCCTCTCGACTGCAGTGCAGGTAACTCAGTAGCCGCGAGAAGCACCCACAGAAGATTTGCCCGAGAAAGGCGACAACCACGACTGCCGTGTGATCCAGACATGAAGCAGCTTTTAGCAGCTTTTATCCTGGTCCAACTAATGAAATCTCCTTACTGTTCTGAAGAGAAGATACACCCTATCGTTTTTGTTAGGCATTAATTCCTTTGGCAATTCATAAGCATAGTCAGGCCTCACATGAG

Full Affymetrix probeset data:

Annotations for 1638126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720