FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638128_at:

>probe:Drosophila_2:1638128_at:505:105; Interrogation_Position=168; Antisense; AAAATCAGTTGGCTGGACCCGGTTG
>probe:Drosophila_2:1638128_at:109:237; Interrogation_Position=221; Antisense; AATCTGAGCTTCTTTCGCAATTGGA
>probe:Drosophila_2:1638128_at:421:657; Interrogation_Position=273; Antisense; TAATGGACGAGTACTTCCTCGGCCT
>probe:Drosophila_2:1638128_at:722:387; Interrogation_Position=299; Antisense; GAAAAGATTCGTGCCTTGACTGCCC
>probe:Drosophila_2:1638128_at:608:415; Interrogation_Position=326; Antisense; GAGCCGCATGAGTTGTATGTACACC
>probe:Drosophila_2:1638128_at:238:609; Interrogation_Position=415; Antisense; TGACGACTACGCCATGAATACACTG
>probe:Drosophila_2:1638128_at:117:21; Interrogation_Position=445; Antisense; ATATTCGGGCACTGCGGGAGATTCC
>probe:Drosophila_2:1638128_at:610:53; Interrogation_Position=488; Antisense; ATGAAGTTCTCCACATATGATCGGG
>probe:Drosophila_2:1638128_at:601:383; Interrogation_Position=535; Antisense; GAACTGTGCATTTTACTATCTGGGA
>probe:Drosophila_2:1638128_at:369:65; Interrogation_Position=562; Antisense; ATGGTGGTACAACGCATGTCTGGAC
>probe:Drosophila_2:1638128_at:308:61; Interrogation_Position=577; Antisense; ATGTCTGGACAGCAACCTTAATGGT
>probe:Drosophila_2:1638128_at:253:77; Interrogation_Position=627; Antisense; AGGAGAGCTTGTTCGCCAGAGGAAT
>probe:Drosophila_2:1638128_at:311:583; Interrogation_Position=665; Antisense; TGGCGTGGCCACAACTACGGATACA
>probe:Drosophila_2:1638128_at:215:411; Interrogation_Position=711; Antisense; GACCCAAGTGCCGAATGATACCAGT

Paste this into a BLAST search page for me
AAAATCAGTTGGCTGGACCCGGTTGAATCTGAGCTTCTTTCGCAATTGGATAATGGACGAGTACTTCCTCGGCCTGAAAAGATTCGTGCCTTGACTGCCCGAGCCGCATGAGTTGTATGTACACCTGACGACTACGCCATGAATACACTGATATTCGGGCACTGCGGGAGATTCCATGAAGTTCTCCACATATGATCGGGGAACTGTGCATTTTACTATCTGGGAATGGTGGTACAACGCATGTCTGGACATGTCTGGACAGCAACCTTAATGGTAGGAGAGCTTGTTCGCCAGAGGAATTGGCGTGGCCACAACTACGGATACAGACCCAAGTGCCGAATGATACCAGT

Full Affymetrix probeset data:

Annotations for 1638128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720