FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638129_at:

>probe:Drosophila_2:1638129_at:503:605; Interrogation_Position=1010; Antisense; TGATGTACTACACCGCTGACTGGGA
>probe:Drosophila_2:1638129_at:348:273; Interrogation_Position=1122; Antisense; CTTCTTCATCACTGGCCTTAATTAT
>probe:Drosophila_2:1638129_at:271:93; Interrogation_Position=1152; Antisense; AGTTAGTCTCACTGCTGTGCTGAAA
>probe:Drosophila_2:1638129_at:151:387; Interrogation_Position=1173; Antisense; GAAAATCATTCAGGGCGCCTTTTCC
>probe:Drosophila_2:1638129_at:156:713; Interrogation_Position=1201; Antisense; TTCACGTTCCTAAATTCGATGCGAT
>probe:Drosophila_2:1638129_at:689:619; Interrogation_Position=660; Antisense; TGCTCGATATATCCAGCTTGGCCAG
>probe:Drosophila_2:1638129_at:683:429; Interrogation_Position=720; Antisense; GAGTAGCTCCTTAAACGTGGCCATC
>probe:Drosophila_2:1638129_at:375:579; Interrogation_Position=737; Antisense; TGGCCATCGCTTACCGGTTAAATTT
>probe:Drosophila_2:1638129_at:385:709; Interrogation_Position=754; Antisense; TTAAATTTGACCCACATCCTGCGAA
>probe:Drosophila_2:1638129_at:115:551; Interrogation_Position=819; Antisense; GGAGTTCACCCTCAGAATATTCGTC
>probe:Drosophila_2:1638129_at:208:691; Interrogation_Position=836; Antisense; TATTCGTCATGTTCGCTTTTAGCGC
>probe:Drosophila_2:1638129_at:568:143; Interrogation_Position=864; Antisense; ACTGCTATGTGCTCTGTTCTTCAAG
>probe:Drosophila_2:1638129_at:634:315; Interrogation_Position=916; Antisense; GCCTACATTGTGTGGTTCCTGGCAA
>probe:Drosophila_2:1638129_at:174:53; Interrogation_Position=967; Antisense; ATGCTCGGCTCAATTCTGCTTAAAA

Paste this into a BLAST search page for me
TGATGTACTACACCGCTGACTGGGACTTCTTCATCACTGGCCTTAATTATAGTTAGTCTCACTGCTGTGCTGAAAGAAAATCATTCAGGGCGCCTTTTCCTTCACGTTCCTAAATTCGATGCGATTGCTCGATATATCCAGCTTGGCCAGGAGTAGCTCCTTAAACGTGGCCATCTGGCCATCGCTTACCGGTTAAATTTTTAAATTTGACCCACATCCTGCGAAGGAGTTCACCCTCAGAATATTCGTCTATTCGTCATGTTCGCTTTTAGCGCACTGCTATGTGCTCTGTTCTTCAAGGCCTACATTGTGTGGTTCCTGGCAAATGCTCGGCTCAATTCTGCTTAAAA

Full Affymetrix probeset data:

Annotations for 1638129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720