Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638130_at:

>probe:Drosophila_2:1638130_at:335:235; Interrogation_Position=1240; Antisense; AATGCCAATGCCAGTACGCGAGAGG
>probe:Drosophila_2:1638130_at:518:423; Interrogation_Position=1279; Antisense; GAGACCATTGATCCGGACGAGCCGA
>probe:Drosophila_2:1638130_at:35:297; Interrogation_Position=1301; Antisense; CGACCTACTGTGTCTGCAATCAGAT
>probe:Drosophila_2:1638130_at:182:691; Interrogation_Position=1330; Antisense; TTTGGCGAGATGATCCTGTGCGACA
>probe:Drosophila_2:1638130_at:356:449; Interrogation_Position=1341; Antisense; GATCCTGTGCGACAATGACCTGTGC
>probe:Drosophila_2:1638130_at:499:609; Interrogation_Position=1356; Antisense; TGACCTGTGCCCCATCGAGTGGTTC
>probe:Drosophila_2:1638130_at:709:433; Interrogation_Position=1372; Antisense; GAGTGGTTCCATTTTTCGTGCGTCT
>probe:Drosophila_2:1638130_at:13:587; Interrogation_Position=1390; Antisense; TGCGTCTCCCTGGTACTAAAACCAA
>probe:Drosophila_2:1638130_at:424:169; Interrogation_Position=1414; Antisense; AAAGGCAAGTGGTTCTGCCCCAACT
>probe:Drosophila_2:1638130_at:589:413; Interrogation_Position=1524; Antisense; GACCTAGTCTATTAGGCCAGCCTAT
>probe:Drosophila_2:1638130_at:592:285; Interrogation_Position=1562; Antisense; CTGTGTCTAACACCAGGCTCTGTAA
>probe:Drosophila_2:1638130_at:383:571; Interrogation_Position=1577; Antisense; GGCTCTGTAAAATATTCGATCCTAA
>probe:Drosophila_2:1638130_at:85:707; Interrogation_Position=1621; Antisense; TTAGTGACTTTCTTAGACCCGATCC
>probe:Drosophila_2:1638130_at:313:539; Interrogation_Position=1694; Antisense; GGTTATAGGTCGTCAGTTTTCATTT

Paste this into a BLAST search page for me
AATGCCAATGCCAGTACGCGAGAGGGAGACCATTGATCCGGACGAGCCGACGACCTACTGTGTCTGCAATCAGATTTTGGCGAGATGATCCTGTGCGACAGATCCTGTGCGACAATGACCTGTGCTGACCTGTGCCCCATCGAGTGGTTCGAGTGGTTCCATTTTTCGTGCGTCTTGCGTCTCCCTGGTACTAAAACCAAAAAGGCAAGTGGTTCTGCCCCAACTGACCTAGTCTATTAGGCCAGCCTATCTGTGTCTAACACCAGGCTCTGTAAGGCTCTGTAAAATATTCGATCCTAATTAGTGACTTTCTTAGACCCGATCCGGTTATAGGTCGTCAGTTTTCATTT

Full Affymetrix probeset data:

Annotations for 1638130_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime