FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638132_at:

>probe:Drosophila_2:1638132_at:611:175; Interrogation_Position=1009; Antisense; AAACTGACGGCCAGTGAGTTCTCCA
>probe:Drosophila_2:1638132_at:8:627; Interrogation_Position=1030; Antisense; TCCACCCGGTTGAGCATCGTTGATG
>probe:Drosophila_2:1638132_at:67:571; Interrogation_Position=1128; Antisense; GGCATTTGCGAGACTTGTGCTCTAC
>probe:Drosophila_2:1638132_at:296:597; Interrogation_Position=1143; Antisense; TGTGCTCTACCATCAGGTGGACGAT
>probe:Drosophila_2:1638132_at:56:57; Interrogation_Position=1166; Antisense; ATGAGCAAGTGGACCTGGCCATCAG
>probe:Drosophila_2:1638132_at:17:121; Interrogation_Position=1193; Antisense; AGCTGAAGTACGTCATCGGCCAGTA
>probe:Drosophila_2:1638132_at:677:487; Interrogation_Position=1215; Antisense; GTACGACAAGCAATTTCCCAGGACC
>probe:Drosophila_2:1638132_at:266:719; Interrogation_Position=1229; Antisense; TTCCCAGGACCTAGACATTTGTAAT
>probe:Drosophila_2:1638132_at:339:593; Interrogation_Position=746; Antisense; TGGGATCCGTGTTAGTCGGCTCCAA
>probe:Drosophila_2:1638132_at:556:225; Interrogation_Position=769; Antisense; AAGGCCTTCATTTCGGAAGCCCATC
>probe:Drosophila_2:1638132_at:681:83; Interrogation_Position=870; Antisense; AGTGGTACCACTTCTGAGCAAAGAT
>probe:Drosophila_2:1638132_at:162:189; Interrogation_Position=946; Antisense; AACATTACCGTACACGTGTCGTCTG
>probe:Drosophila_2:1638132_at:313:639; Interrogation_Position=964; Antisense; TCGTCTGTCCAGAGCAATATCCTTC
>probe:Drosophila_2:1638132_at:539:427; Interrogation_Position=994; Antisense; GAGATAACCCAACCCAAACTGACGG

Paste this into a BLAST search page for me
AAACTGACGGCCAGTGAGTTCTCCATCCACCCGGTTGAGCATCGTTGATGGGCATTTGCGAGACTTGTGCTCTACTGTGCTCTACCATCAGGTGGACGATATGAGCAAGTGGACCTGGCCATCAGAGCTGAAGTACGTCATCGGCCAGTAGTACGACAAGCAATTTCCCAGGACCTTCCCAGGACCTAGACATTTGTAATTGGGATCCGTGTTAGTCGGCTCCAAAAGGCCTTCATTTCGGAAGCCCATCAGTGGTACCACTTCTGAGCAAAGATAACATTACCGTACACGTGTCGTCTGTCGTCTGTCCAGAGCAATATCCTTCGAGATAACCCAACCCAAACTGACGG

Full Affymetrix probeset data:

Annotations for 1638132_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720