FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638133_at:

>probe:Drosophila_2:1638133_at:79:241; Interrogation_Position=1060; Antisense; AATAGAGCTCCGGTTGATTTCGTCG
>probe:Drosophila_2:1638133_at:108:541; Interrogation_Position=1071; Antisense; GGTTGATTTCGTCGCACACCGCTAT
>probe:Drosophila_2:1638133_at:455:707; Interrogation_Position=1118; Antisense; TTACGTTATAAAATCCATGCTGGGA
>probe:Drosophila_2:1638133_at:357:661; Interrogation_Position=1219; Antisense; TAAAACGCGCACTTGCGCTATCAAT
>probe:Drosophila_2:1638133_at:641:323; Interrogation_Position=1233; Antisense; GCGCTATCAATTCCCACAAACAATA
>probe:Drosophila_2:1638133_at:14:683; Interrogation_Position=1285; Antisense; TATGTTAAACTGTTGGCATGCCTTT
>probe:Drosophila_2:1638133_at:307:569; Interrogation_Position=1299; Antisense; GGCATGCCTTTTCTGGACCATTTCA
>probe:Drosophila_2:1638133_at:113:663; Interrogation_Position=1357; Antisense; TAAATTATGATTTCCCGAGTTCGTA
>probe:Drosophila_2:1638133_at:333:599; Interrogation_Position=1364; Antisense; TGATTTCCCGAGTTCGTAATTTTCT
>probe:Drosophila_2:1638133_at:60:533; Interrogation_Position=860; Antisense; GGTGGCCTATGAGTATGAACATCGT
>probe:Drosophila_2:1638133_at:382:205; Interrogation_Position=894; Antisense; AAGCGTCCGCCTACGGGCTATGAGT
>probe:Drosophila_2:1638133_at:73:491; Interrogation_Position=917; Antisense; GTACAGCAAACCACGTCCATCAATA
>probe:Drosophila_2:1638133_at:709:31; Interrogation_Position=939; Antisense; ATAATACCGACAAACGCAGCGGCAT
>probe:Drosophila_2:1638133_at:379:353; Interrogation_Position=954; Antisense; GCAGCGGCATATAAACGTCCATATC

Paste this into a BLAST search page for me
AATAGAGCTCCGGTTGATTTCGTCGGGTTGATTTCGTCGCACACCGCTATTTACGTTATAAAATCCATGCTGGGATAAAACGCGCACTTGCGCTATCAATGCGCTATCAATTCCCACAAACAATATATGTTAAACTGTTGGCATGCCTTTGGCATGCCTTTTCTGGACCATTTCATAAATTATGATTTCCCGAGTTCGTATGATTTCCCGAGTTCGTAATTTTCTGGTGGCCTATGAGTATGAACATCGTAAGCGTCCGCCTACGGGCTATGAGTGTACAGCAAACCACGTCCATCAATAATAATACCGACAAACGCAGCGGCATGCAGCGGCATATAAACGTCCATATC

Full Affymetrix probeset data:

Annotations for 1638133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720