Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638136_at:

>probe:Drosophila_2:1638136_at:454:527; Interrogation_Position=2546; Antisense; GGGAGTTCAGATATCCGCGAGTGAA
>probe:Drosophila_2:1638136_at:329:299; Interrogation_Position=2561; Antisense; CGCGAGTGAATCAGGGATCCTTCAA
>probe:Drosophila_2:1638136_at:432:223; Interrogation_Position=2584; Antisense; AAGGTGGACAACAACGGCATGGGCA
>probe:Drosophila_2:1638136_at:460:17; Interrogation_Position=2642; Antisense; ATTTGAAGACCGAGGCGGCCACAAC
>probe:Drosophila_2:1638136_at:478:253; Interrogation_Position=2663; Antisense; CAACGCGACACAACTTCCTGGAGGA
>probe:Drosophila_2:1638136_at:222:589; Interrogation_Position=2681; Antisense; TGGAGGAGACCGAGGCGCCATTCAA
>probe:Drosophila_2:1638136_at:111:203; Interrogation_Position=2704; Antisense; AAGCCAAATCGACGACGCTCGCTAA
>probe:Drosophila_2:1638136_at:118:279; Interrogation_Position=2793; Antisense; CTGCAACCGTAATCCGCACTAGTAA
>probe:Drosophila_2:1638136_at:726:407; Interrogation_Position=2890; Antisense; GACGTAAGAAGTACACTCCCTGCAC
>probe:Drosophila_2:1638136_at:397:355; Interrogation_Position=2911; Antisense; GCACAGCCACGTAATTGGTCTTCAA
>probe:Drosophila_2:1638136_at:119:613; Interrogation_Position=2949; Antisense; TGAAACAGTTGTTGGCATTGCCCCG
>probe:Drosophila_2:1638136_at:416:297; Interrogation_Position=3038; Antisense; CGCATCCATATTCCTGGCCAAAAGT
>probe:Drosophila_2:1638136_at:132:417; Interrogation_Position=3068; Antisense; GAGCTACCGCTTCCCAAAGACTTGT
>probe:Drosophila_2:1638136_at:630:171; Interrogation_Position=3083; Antisense; AAAGACTTGTGTCACCGGCAGAAAT

Paste this into a BLAST search page for me
GGGAGTTCAGATATCCGCGAGTGAACGCGAGTGAATCAGGGATCCTTCAAAAGGTGGACAACAACGGCATGGGCAATTTGAAGACCGAGGCGGCCACAACCAACGCGACACAACTTCCTGGAGGATGGAGGAGACCGAGGCGCCATTCAAAAGCCAAATCGACGACGCTCGCTAACTGCAACCGTAATCCGCACTAGTAAGACGTAAGAAGTACACTCCCTGCACGCACAGCCACGTAATTGGTCTTCAATGAAACAGTTGTTGGCATTGCCCCGCGCATCCATATTCCTGGCCAAAAGTGAGCTACCGCTTCCCAAAGACTTGTAAAGACTTGTGTCACCGGCAGAAAT

Full Affymetrix probeset data:

Annotations for 1638136_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime