FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638137_at:

>probe:Drosophila_2:1638137_at:678:449; Interrogation_Position=1039; Antisense; GATCGCGTCTGTGGAGGCACCTTTA
>probe:Drosophila_2:1638137_at:216:509; Interrogation_Position=1093; Antisense; GTGCAATCAAGTGTTCGTCCTTTCC
>probe:Drosophila_2:1638137_at:213:569; Interrogation_Position=1118; Antisense; GGCTTTATTTCCACACGGACGGAGT
>probe:Drosophila_2:1638137_at:583:397; Interrogation_Position=1162; Antisense; GACAACCGAGGATTTTGCCTTGATT
>probe:Drosophila_2:1638137_at:128:501; Interrogation_Position=621; Antisense; GTCGGTGATCACCAGCGGAAGTTTT
>probe:Drosophila_2:1638137_at:694:215; Interrogation_Position=639; Antisense; AAGTTTTCCGCGTCTGTGGCGAATC
>probe:Drosophila_2:1638137_at:492:121; Interrogation_Position=699; Antisense; AGCGGACCAAGGCTGTCTGCAGTAC
>probe:Drosophila_2:1638137_at:206:537; Interrogation_Position=739; Antisense; GGTCGTGTGCGCAGCTTTAATTACA
>probe:Drosophila_2:1638137_at:79:91; Interrogation_Position=842; Antisense; AGTACAACGCATGTCCGGATCTGGA
>probe:Drosophila_2:1638137_at:688:97; Interrogation_Position=880; Antisense; AGATCGTTCACACTCACTGGGAACT
>probe:Drosophila_2:1638137_at:275:569; Interrogation_Position=943; Antisense; GGCATGCCACCAAACTTGAACGGTT
>probe:Drosophila_2:1638137_at:326:383; Interrogation_Position=960; Antisense; GAACGGTTGCACAAGCGATTGGCTA
>probe:Drosophila_2:1638137_at:514:729; Interrogation_Position=978; Antisense; TTGGCTACTGATTGGTTGCATTCGA
>probe:Drosophila_2:1638137_at:342:11; Interrogation_Position=997; Antisense; ATTCGATCGGCGGACAGGATTCCTC

Paste this into a BLAST search page for me
GATCGCGTCTGTGGAGGCACCTTTAGTGCAATCAAGTGTTCGTCCTTTCCGGCTTTATTTCCACACGGACGGAGTGACAACCGAGGATTTTGCCTTGATTGTCGGTGATCACCAGCGGAAGTTTTAAGTTTTCCGCGTCTGTGGCGAATCAGCGGACCAAGGCTGTCTGCAGTACGGTCGTGTGCGCAGCTTTAATTACAAGTACAACGCATGTCCGGATCTGGAAGATCGTTCACACTCACTGGGAACTGGCATGCCACCAAACTTGAACGGTTGAACGGTTGCACAAGCGATTGGCTATTGGCTACTGATTGGTTGCATTCGAATTCGATCGGCGGACAGGATTCCTC

Full Affymetrix probeset data:

Annotations for 1638137_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720