FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638138_at:

>probe:Drosophila_2:1638138_at:335:727; Interrogation_Position=1015; Antisense; TTGGCAAACCGTGCGTGGTTGTTCT
>probe:Drosophila_2:1638138_at:249:179; Interrogation_Position=1049; Antisense; AAACACCCACATGCCGGAGAATCTG
>probe:Drosophila_2:1638138_at:705:47; Interrogation_Position=1080; Antisense; ATCCTCGGACTGGTCATGATCTTCG
>probe:Drosophila_2:1638138_at:677:269; Interrogation_Position=1094; Antisense; CATGATCTTCGTCGACGGTGTGAAT
>probe:Drosophila_2:1638138_at:183:619; Interrogation_Position=1172; Antisense; TGCTTGTATCCTCCACATCTAAATT
>probe:Drosophila_2:1638138_at:558:537; Interrogation_Position=1265; Antisense; GGTCATGTTGCTTCACTGTCTTAAA
>probe:Drosophila_2:1638138_at:104:559; Interrogation_Position=824; Antisense; GGACAATCCCATGCACCTGATGGTG
>probe:Drosophila_2:1638138_at:379:139; Interrogation_Position=853; Antisense; ACGTTTTGCGTGAAAGCGGCTGTCC
>probe:Drosophila_2:1638138_at:645:573; Interrogation_Position=870; Antisense; GGCTGTCCGATGCATATGCTCAATA
>probe:Drosophila_2:1638138_at:706:715; Interrogation_Position=901; Antisense; TTGAACGTTGCCACGAGGATCGCTG
>probe:Drosophila_2:1638138_at:471:449; Interrogation_Position=918; Antisense; GATCGCTGGCCCGAAGGTCTGATGA
>probe:Drosophila_2:1638138_at:463:611; Interrogation_Position=940; Antisense; TGACGTTGGACGATCGCCGCGAGAA
>probe:Drosophila_2:1638138_at:391:271; Interrogation_Position=969; Antisense; CATCTCATGAGTCGGTATGTCACCC
>probe:Drosophila_2:1638138_at:76:535; Interrogation_Position=998; Antisense; GGTGCCCGGTCTGGTCATTGGCAAA

Paste this into a BLAST search page for me
TTGGCAAACCGTGCGTGGTTGTTCTAAACACCCACATGCCGGAGAATCTGATCCTCGGACTGGTCATGATCTTCGCATGATCTTCGTCGACGGTGTGAATTGCTTGTATCCTCCACATCTAAATTGGTCATGTTGCTTCACTGTCTTAAAGGACAATCCCATGCACCTGATGGTGACGTTTTGCGTGAAAGCGGCTGTCCGGCTGTCCGATGCATATGCTCAATATTGAACGTTGCCACGAGGATCGCTGGATCGCTGGCCCGAAGGTCTGATGATGACGTTGGACGATCGCCGCGAGAACATCTCATGAGTCGGTATGTCACCCGGTGCCCGGTCTGGTCATTGGCAAA

Full Affymetrix probeset data:

Annotations for 1638138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720