FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638139_at:

>probe:Drosophila_2:1638139_at:244:29; Interrogation_Position=1018; Antisense; ATAAATTCTGTGGTTACCGGCCTGC
>probe:Drosophila_2:1638139_at:396:689; Interrogation_Position=1054; Antisense; TTTGGAGCCCATCTTCAACTGGAGG
>probe:Drosophila_2:1638139_at:376:147; Interrogation_Position=1204; Antisense; ACTAAATCCTCAGTGCTCTCGATAC
>probe:Drosophila_2:1638139_at:636:455; Interrogation_Position=1224; Antisense; GATACCTTACCCTAGTGACAACCAG
>probe:Drosophila_2:1638139_at:651:469; Interrogation_Position=1248; Antisense; GTTCATCGAATTCACCAACACGGGC
>probe:Drosophila_2:1638139_at:366:507; Interrogation_Position=1300; Antisense; GTGCCCTTCATCGATATTCAGGACG
>probe:Drosophila_2:1638139_at:618:9; Interrogation_Position=1315; Antisense; ATTCAGGACGTTGTATCGGACCCAC
>probe:Drosophila_2:1638139_at:171:703; Interrogation_Position=1397; Antisense; TTTTGGCGCCACGAATCATTACCTA
>probe:Drosophila_2:1638139_at:72:15; Interrogation_Position=1414; Antisense; ATTACCTACGATTTCACCTCATATG
>probe:Drosophila_2:1638139_at:672:711; Interrogation_Position=1426; Antisense; TTCACCTCATATGTTCAGATCCCAA
>probe:Drosophila_2:1638139_at:672:651; Interrogation_Position=884; Antisense; TCAACGGGACAACTCTTCGGTGGAA
>probe:Drosophila_2:1638139_at:178:327; Interrogation_Position=902; Antisense; GGTGGAAGCCCGTGGATTCGTACTC
>probe:Drosophila_2:1638139_at:294:463; Interrogation_Position=916; Antisense; GATTCGTACTCCATATCCGACAAGG
>probe:Drosophila_2:1638139_at:57:1; Interrogation_Position=956; Antisense; TTGACTACCATACACTAACCTACGA

Paste this into a BLAST search page for me
ATAAATTCTGTGGTTACCGGCCTGCTTTGGAGCCCATCTTCAACTGGAGGACTAAATCCTCAGTGCTCTCGATACGATACCTTACCCTAGTGACAACCAGGTTCATCGAATTCACCAACACGGGCGTGCCCTTCATCGATATTCAGGACGATTCAGGACGTTGTATCGGACCCACTTTTGGCGCCACGAATCATTACCTAATTACCTACGATTTCACCTCATATGTTCACCTCATATGTTCAGATCCCAATCAACGGGACAACTCTTCGGTGGAAGGTGGAAGCCCGTGGATTCGTACTCGATTCGTACTCCATATCCGACAAGGTTGACTACCATACACTAACCTACGA

Full Affymetrix probeset data:

Annotations for 1638139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720