FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638140_at:

>probe:Drosophila_2:1638140_at:343:95; Interrogation_Position=1404; Antisense; AGATCTTTTGGATCTGCTTGACCCC
>probe:Drosophila_2:1638140_at:223:335; Interrogation_Position=1419; Antisense; GCTTGACCCCATCTTTTACATGAAG
>probe:Drosophila_2:1638140_at:314:155; Interrogation_Position=1474; Antisense; ACAGCTCATGCTGCCGTGATGGATG
>probe:Drosophila_2:1638140_at:584:441; Interrogation_Position=1491; Antisense; GATGGATGTCCGTCTCGACATCATT
>probe:Drosophila_2:1638140_at:108:419; Interrogation_Position=1593; Antisense; GAGCTATGTCAAATCCTATCTGGTC
>probe:Drosophila_2:1638140_at:360:227; Interrogation_Position=1634; Antisense; AATGGCGACCCAACATGGACGTGGA
>probe:Drosophila_2:1638140_at:125:43; Interrogation_Position=1693; Antisense; ATCGGTCGCATCTACTACAAGCTGA
>probe:Drosophila_2:1638140_at:52:665; Interrogation_Position=1708; Antisense; TACAAGCTGATCAGTGGCCATCCGC
>probe:Drosophila_2:1638140_at:654:587; Interrogation_Position=1742; Antisense; TGGAGCACCTAACTAGTTGCCACAC
>probe:Drosophila_2:1638140_at:104:469; Interrogation_Position=1757; Antisense; GTTGCCACACCTACTACCAGAGATT
>probe:Drosophila_2:1638140_at:468:265; Interrogation_Position=1774; Antisense; CAGAGATTCGATGCTGGTTGCCAGC
>probe:Drosophila_2:1638140_at:22:729; Interrogation_Position=1841; Antisense; TTGTGCGTGAAATGCTCCAGCTGTT
>probe:Drosophila_2:1638140_at:56:719; Interrogation_Position=1897; Antisense; TTGAACAAGGCTGGGCTAACCGCGT
>probe:Drosophila_2:1638140_at:52:571; Interrogation_Position=1910; Antisense; GGCTAACCGCGTGAGAATTTCCAAA

Paste this into a BLAST search page for me
AGATCTTTTGGATCTGCTTGACCCCGCTTGACCCCATCTTTTACATGAAGACAGCTCATGCTGCCGTGATGGATGGATGGATGTCCGTCTCGACATCATTGAGCTATGTCAAATCCTATCTGGTCAATGGCGACCCAACATGGACGTGGAATCGGTCGCATCTACTACAAGCTGATACAAGCTGATCAGTGGCCATCCGCTGGAGCACCTAACTAGTTGCCACACGTTGCCACACCTACTACCAGAGATTCAGAGATTCGATGCTGGTTGCCAGCTTGTGCGTGAAATGCTCCAGCTGTTTTGAACAAGGCTGGGCTAACCGCGTGGCTAACCGCGTGAGAATTTCCAAA

Full Affymetrix probeset data:

Annotations for 1638140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720