FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638142_at:

>probe:Drosophila_2:1638142_at:211:161; Interrogation_Position=113; Antisense; ACAAGATCTATGTCTCCGTCTACGA
>probe:Drosophila_2:1638142_at:407:143; Interrogation_Position=189; Antisense; ACTGCGTCACTCCAATCATGCGATG
>probe:Drosophila_2:1638142_at:637:669; Interrogation_Position=218; Antisense; TACGGGAATACCTGGACAGCTCGCT
>probe:Drosophila_2:1638142_at:503:295; Interrogation_Position=266; Antisense; CGAGCTTACGGTCAGTTTGGATTCA
>probe:Drosophila_2:1638142_at:192:463; Interrogation_Position=285; Antisense; GATTCAGAACCGGTCACAGATCCTG
>probe:Drosophila_2:1638142_at:173:97; Interrogation_Position=302; Antisense; AGATCCTGGAGACCTCTTCGGTGAT
>probe:Drosophila_2:1638142_at:28:607; Interrogation_Position=323; Antisense; TGATGCGTATAGTGCTCTCCCTGGA
>probe:Drosophila_2:1638142_at:418:429; Interrogation_Position=370; Antisense; GAGTTCGATGTTAGTTCCAGCCGGA
>probe:Drosophila_2:1638142_at:365:371; Interrogation_Position=393; Antisense; GAAGGCCATCAGTTTCTTGTGCAAC
>probe:Drosophila_2:1638142_at:121:71; Interrogation_Position=454; Antisense; AGGCCTTCTGGGTCCTTGCATATAG
>probe:Drosophila_2:1638142_at:23:685; Interrogation_Position=474; Antisense; TATAGTGCGGTTCTATGACCACCTC
>probe:Drosophila_2:1638142_at:546:321; Interrogation_Position=510; Antisense; GCGCCTCAAAGTCATGCTCAAGTGT
>probe:Drosophila_2:1638142_at:442:69; Interrogation_Position=556; Antisense; AGGCCGGACAGTCGTATCCAGTTGA
>probe:Drosophila_2:1638142_at:84:611; Interrogation_Position=578; Antisense; TGACCCTCGACGACGTGATCCAGGA

Paste this into a BLAST search page for me
ACAAGATCTATGTCTCCGTCTACGAACTGCGTCACTCCAATCATGCGATGTACGGGAATACCTGGACAGCTCGCTCGAGCTTACGGTCAGTTTGGATTCAGATTCAGAACCGGTCACAGATCCTGAGATCCTGGAGACCTCTTCGGTGATTGATGCGTATAGTGCTCTCCCTGGAGAGTTCGATGTTAGTTCCAGCCGGAGAAGGCCATCAGTTTCTTGTGCAACAGGCCTTCTGGGTCCTTGCATATAGTATAGTGCGGTTCTATGACCACCTCGCGCCTCAAAGTCATGCTCAAGTGTAGGCCGGACAGTCGTATCCAGTTGATGACCCTCGACGACGTGATCCAGGA

Full Affymetrix probeset data:

Annotations for 1638142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720