Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638146_at:

>probe:Drosophila_2:1638146_at:151:69; Interrogation_Position=1018; Antisense; ATGGCTGGCGGCACTCTATATAGCA
>probe:Drosophila_2:1638146_at:608:183; Interrogation_Position=1050; Antisense; AAAAGCATGTCTCCAAATTCCTCAC
>probe:Drosophila_2:1638146_at:373:249; Interrogation_Position=1087; Antisense; CAATTACACCGTTCACTTTCTGCAA
>probe:Drosophila_2:1638146_at:228:191; Interrogation_Position=1110; Antisense; AACATTTGCGCGACTTCTTCTCGAT
>probe:Drosophila_2:1638146_at:225:625; Interrogation_Position=1188; Antisense; TGCGCGGTGCCCAGAAGGTTCTTAT
>probe:Drosophila_2:1638146_at:291:619; Interrogation_Position=761; Antisense; TGCATGCTAAAGTTCCTGCCGGATG
>probe:Drosophila_2:1638146_at:120:471; Interrogation_Position=772; Antisense; GTTCCTGCCGGATGTCTATATTTAC
>probe:Drosophila_2:1638146_at:88:655; Interrogation_Position=826; Antisense; TAATTCGCCCGGATTTGGCATCTGT
>probe:Drosophila_2:1638146_at:276:347; Interrogation_Position=843; Antisense; GCATCTGTCTGATTGCCGAGACTAC
>probe:Drosophila_2:1638146_at:353:103; Interrogation_Position=861; Antisense; AGACTACGGACGGTGTGTGCTTCGC
>probe:Drosophila_2:1638146_at:391:319; Interrogation_Position=887; Antisense; GCCGATTGCTGTTCCAACACAAGAG
>probe:Drosophila_2:1638146_at:174:545; Interrogation_Position=922; Antisense; GGATACACCATCCATACCCGAGAAT
>probe:Drosophila_2:1638146_at:554:81; Interrogation_Position=957; Antisense; AGGTGGCACTGCGTTTGCTAGACGA
>probe:Drosophila_2:1638146_at:200:703; Interrogation_Position=985; Antisense; TTATCGCGGTGGCTGTGTAGACTCC

Paste this into a BLAST search page for me
ATGGCTGGCGGCACTCTATATAGCAAAAAGCATGTCTCCAAATTCCTCACCAATTACACCGTTCACTTTCTGCAAAACATTTGCGCGACTTCTTCTCGATTGCGCGGTGCCCAGAAGGTTCTTATTGCATGCTAAAGTTCCTGCCGGATGGTTCCTGCCGGATGTCTATATTTACTAATTCGCCCGGATTTGGCATCTGTGCATCTGTCTGATTGCCGAGACTACAGACTACGGACGGTGTGTGCTTCGCGCCGATTGCTGTTCCAACACAAGAGGGATACACCATCCATACCCGAGAATAGGTGGCACTGCGTTTGCTAGACGATTATCGCGGTGGCTGTGTAGACTCC

Full Affymetrix probeset data:

Annotations for 1638146_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime