FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638147_at:

>probe:Drosophila_2:1638147_at:671:75; Interrogation_Position=304; Antisense; AGGAGGTGGACATCTACCGGGACAC
>probe:Drosophila_2:1638147_at:545:527; Interrogation_Position=322; Antisense; GGGACACCTTCATTCGCTATATGGG
>probe:Drosophila_2:1638147_at:464:669; Interrogation_Position=411; Antisense; TACGGCATGGCCATCGGATACGTCT
>probe:Drosophila_2:1638147_at:542:455; Interrogation_Position=427; Antisense; GATACGTCTGCACGGACACTTTTGA
>probe:Drosophila_2:1638147_at:38:397; Interrogation_Position=441; Antisense; GACACTTTTGACAAGGCACTGCGCC
>probe:Drosophila_2:1638147_at:643:719; Interrogation_Position=482; Antisense; TTCCTCCAGAGAAGTGGCCGTCAAG
>probe:Drosophila_2:1638147_at:318:497; Interrogation_Position=561; Antisense; GTCATCAATCGGATCACCTGGGCCA
>probe:Drosophila_2:1638147_at:262:523; Interrogation_Position=580; Antisense; GGGCCACCAAAACACTGCTGAGCAA
>probe:Drosophila_2:1638147_at:471:589; Interrogation_Position=643; Antisense; TGGGTCTGGCCAGCATACCGCTTAT
>probe:Drosophila_2:1638147_at:179:7; Interrogation_Position=678; Antisense; ATTGACAGCATGGTTGACCGCCTGA
>probe:Drosophila_2:1638147_at:594:547; Interrogation_Position=748; Antisense; GGATGTGCACAGCATTGGCCCAACT
>probe:Drosophila_2:1638147_at:306:669; Interrogation_Position=791; Antisense; TACTCCACGGTGATAGTTCTTAGAT
>probe:Drosophila_2:1638147_at:617:207; Interrogation_Position=842; Antisense; AAGCTTTAGCCCCAAATCCAGTTTG
>probe:Drosophila_2:1638147_at:384:235; Interrogation_Position=856; Antisense; AATCCAGTTTGCATATTGACCAGAA

Paste this into a BLAST search page for me
AGGAGGTGGACATCTACCGGGACACGGGACACCTTCATTCGCTATATGGGTACGGCATGGCCATCGGATACGTCTGATACGTCTGCACGGACACTTTTGAGACACTTTTGACAAGGCACTGCGCCTTCCTCCAGAGAAGTGGCCGTCAAGGTCATCAATCGGATCACCTGGGCCAGGGCCACCAAAACACTGCTGAGCAATGGGTCTGGCCAGCATACCGCTTATATTGACAGCATGGTTGACCGCCTGAGGATGTGCACAGCATTGGCCCAACTTACTCCACGGTGATAGTTCTTAGATAAGCTTTAGCCCCAAATCCAGTTTGAATCCAGTTTGCATATTGACCAGAA

Full Affymetrix probeset data:

Annotations for 1638147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720