FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638148_at:

>probe:Drosophila_2:1638148_at:132:477; Interrogation_Position=139; Antisense; GTTTATCTGCTGAGGCCTTTGTACA
>probe:Drosophila_2:1638148_at:42:613; Interrogation_Position=18; Antisense; TGAACCCAACATCGTCTACAAACTG
>probe:Drosophila_2:1638148_at:200:111; Interrogation_Position=190; Antisense; AGCAACAAGTTTCAGCCGTTCCTCG
>probe:Drosophila_2:1638148_at:232:305; Interrogation_Position=205; Antisense; CCGTTCCTCGTAGACGTCGTGATAA
>probe:Drosophila_2:1638148_at:410:327; Interrogation_Position=236; Antisense; GCGATGCATTATCCAGGCGTAGCTT
>probe:Drosophila_2:1638148_at:688:27; Interrogation_Position=262; Antisense; ATACCATATGGCTTGATCATCCTGA
>probe:Drosophila_2:1638148_at:367:387; Interrogation_Position=285; Antisense; GAAAATTGCCAGGACGTTCTCGAAC
>probe:Drosophila_2:1638148_at:145:471; Interrogation_Position=300; Antisense; GTTCTCGAACTTTAATCACTCCTGT
>probe:Drosophila_2:1638148_at:244:219; Interrogation_Position=358; Antisense; TACTTGAACGAATCCTACTTGCCCA
>probe:Drosophila_2:1638148_at:709:387; Interrogation_Position=427; Antisense; GAAAACTACATAACTCCACCGAGCG
>probe:Drosophila_2:1638148_at:425:163; Interrogation_Position=45; Antisense; AAATATCGAGTGCTCCACAGTGCCT
>probe:Drosophila_2:1638148_at:490:703; Interrogation_Position=467; Antisense; TTATCTGGTACGTTCAGGCCATGCA
>probe:Drosophila_2:1638148_at:252:155; Interrogation_Position=61; Antisense; ACAGTGCCTGGATTCTCCGCGAATG
>probe:Drosophila_2:1638148_at:28:283; Interrogation_Position=75; Antisense; CTCCGCGAATGCTTCGTGTCATATA

Paste this into a BLAST search page for me
GTTTATCTGCTGAGGCCTTTGTACATGAACCCAACATCGTCTACAAACTGAGCAACAAGTTTCAGCCGTTCCTCGCCGTTCCTCGTAGACGTCGTGATAAGCGATGCATTATCCAGGCGTAGCTTATACCATATGGCTTGATCATCCTGAGAAAATTGCCAGGACGTTCTCGAACGTTCTCGAACTTTAATCACTCCTGTTACTTGAACGAATCCTACTTGCCCAGAAAACTACATAACTCCACCGAGCGAAATATCGAGTGCTCCACAGTGCCTTTATCTGGTACGTTCAGGCCATGCAACAGTGCCTGGATTCTCCGCGAATGCTCCGCGAATGCTTCGTGTCATATA

Full Affymetrix probeset data:

Annotations for 1638148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720