FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638154_at:

>probe:Drosophila_2:1638154_at:123:209; Interrogation_Position=2012; Antisense; AAGCATTATCGTCAGCGTGGTCGCC
>probe:Drosophila_2:1638154_at:113:503; Interrogation_Position=2031; Antisense; GTCGCCATGGTGTGGATTATCGCCA
>probe:Drosophila_2:1638154_at:638:217; Interrogation_Position=2088; Antisense; AAGTACGAGGTGCTGCCTAACTCAC
>probe:Drosophila_2:1638154_at:31:513; Interrogation_Position=2122; Antisense; GTGAGGCCAGAGGTCTTTACATGAT
>probe:Drosophila_2:1638154_at:451:611; Interrogation_Position=2168; Antisense; TGACTTCACTCCTGTCACGATGAAA
>probe:Drosophila_2:1638154_at:479:315; Interrogation_Position=2220; Antisense; GCCTTCCATAGCGATCGGGATTTTT
>probe:Drosophila_2:1638154_at:80:531; Interrogation_Position=2236; Antisense; GGGATTTTTCTCTATACGACATCTC
>probe:Drosophila_2:1638154_at:45:137; Interrogation_Position=2251; Antisense; ACGACATCTCGTTCTATTGGTACAA
>probe:Drosophila_2:1638154_at:495:729; Interrogation_Position=2267; Antisense; TTGGTACAAGGTTCTGGGCAGCGCT
>probe:Drosophila_2:1638154_at:39:715; Interrogation_Position=2299; Antisense; TTCTATGTGCGATCCCATTGAGCTA
>probe:Drosophila_2:1638154_at:206:273; Interrogation_Position=2314; Antisense; CATTGAGCTATATCTGGCGACCCGA
>probe:Drosophila_2:1638154_at:108:109; Interrogation_Position=2353; Antisense; AGAATCCAAAGTTGTACTCGCCCTT
>probe:Drosophila_2:1638154_at:392:77; Interrogation_Position=2422; Antisense; AGGAGGTGCCACTTCGAGGATCCAA
>probe:Drosophila_2:1638154_at:220:131; Interrogation_Position=2505; Antisense; ACCGAGCCCTGATTCTTGTTAAATG

Paste this into a BLAST search page for me
AAGCATTATCGTCAGCGTGGTCGCCGTCGCCATGGTGTGGATTATCGCCAAAGTACGAGGTGCTGCCTAACTCACGTGAGGCCAGAGGTCTTTACATGATTGACTTCACTCCTGTCACGATGAAAGCCTTCCATAGCGATCGGGATTTTTGGGATTTTTCTCTATACGACATCTCACGACATCTCGTTCTATTGGTACAATTGGTACAAGGTTCTGGGCAGCGCTTTCTATGTGCGATCCCATTGAGCTACATTGAGCTATATCTGGCGACCCGAAGAATCCAAAGTTGTACTCGCCCTTAGGAGGTGCCACTTCGAGGATCCAAACCGAGCCCTGATTCTTGTTAAATG

Full Affymetrix probeset data:

Annotations for 1638154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720