FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638155_at:

>probe:Drosophila_2:1638155_at:549:129; Interrogation_Position=113; Antisense; ACCGCAAGGATGTGACGTTGGAGTC
>probe:Drosophila_2:1638155_at:7:59; Interrogation_Position=13; Antisense; ATGATGGTGGCTGGCTCCTTTGGAC
>probe:Drosophila_2:1638155_at:127:501; Interrogation_Position=135; Antisense; GTCGGAGTACGACAAAGTCAAGTCC
>probe:Drosophila_2:1638155_at:216:295; Interrogation_Position=144; Antisense; CGACAAAGTCAAGTCCGTGGACATA
>probe:Drosophila_2:1638155_at:209:291; Interrogation_Position=159; Antisense; CGTGGACATAGAGAACTGGGAGAAC
>probe:Drosophila_2:1638155_at:289:591; Interrogation_Position=175; Antisense; TGGGAGAACAAACGCGGTCCACGTC
>probe:Drosophila_2:1638155_at:23:255; Interrogation_Position=183; Antisense; CAAACGCGGTCCACGTCCCTGGGAG
>probe:Drosophila_2:1638155_at:464:115; Interrogation_Position=209; Antisense; AGCAGGAAGATCAGCCGACGACAGC
>probe:Drosophila_2:1638155_at:360:645; Interrogation_Position=219; Antisense; TCAGCCGACGACAGCGAAGCACTAG
>probe:Drosophila_2:1638155_at:133:583; Interrogation_Position=24; Antisense; TGGCTCCTTTGGACTGCAGCAGTAT
>probe:Drosophila_2:1638155_at:24:407; Interrogation_Position=35; Antisense; GACTGCAGCAGTATCAGTACGCCAA
>probe:Drosophila_2:1638155_at:180:351; Interrogation_Position=42; Antisense; GCAGTATCAGTACGCCAAGAAGCAG
>probe:Drosophila_2:1638155_at:376:425; Interrogation_Position=82; Antisense; GAGATGAAAAAGTACGGCGTAAGCA
>probe:Drosophila_2:1638155_at:596:291; Interrogation_Position=99; Antisense; CGTAAGCATGAAAAACCGCAAGGAT

Paste this into a BLAST search page for me
ACCGCAAGGATGTGACGTTGGAGTCATGATGGTGGCTGGCTCCTTTGGACGTCGGAGTACGACAAAGTCAAGTCCCGACAAAGTCAAGTCCGTGGACATACGTGGACATAGAGAACTGGGAGAACTGGGAGAACAAACGCGGTCCACGTCCAAACGCGGTCCACGTCCCTGGGAGAGCAGGAAGATCAGCCGACGACAGCTCAGCCGACGACAGCGAAGCACTAGTGGCTCCTTTGGACTGCAGCAGTATGACTGCAGCAGTATCAGTACGCCAAGCAGTATCAGTACGCCAAGAAGCAGGAGATGAAAAAGTACGGCGTAAGCACGTAAGCATGAAAAACCGCAAGGAT

Full Affymetrix probeset data:

Annotations for 1638155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720