FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638156_at:

>probe:Drosophila_2:1638156_at:556:87; Interrogation_Position=1326; Antisense; AGTCGGCGAGTGTCAAGCGCATCAT
>probe:Drosophila_2:1638156_at:247:123; Interrogation_Position=1341; Antisense; AGCGCATCATTGTGGGCGATCTACA
>probe:Drosophila_2:1638156_at:90:453; Interrogation_Position=1358; Antisense; GATCTACAGCGCTTGGACATTCTAA
>probe:Drosophila_2:1638156_at:543:349; Interrogation_Position=1409; Antisense; GCAGTCCACCAATTTGAAACCCAGT
>probe:Drosophila_2:1638156_at:319:391; Interrogation_Position=1424; Antisense; GAAACCCAGTCGTCCAGCAATAAAA
>probe:Drosophila_2:1638156_at:346:83; Interrogation_Position=1456; Antisense; AGTGGACCAATATAGCTGCTCGGAC
>probe:Drosophila_2:1638156_at:516:277; Interrogation_Position=1480; Antisense; CTACCACAAGTGCTATGCCCATATG
>probe:Drosophila_2:1638156_at:542:417; Interrogation_Position=1508; Antisense; GAGCTGGGCAATGTCATATTCTTGT
>probe:Drosophila_2:1638156_at:613:21; Interrogation_Position=1523; Antisense; ATATTCTTGTTGTTTGTGGCAGCGG
>probe:Drosophila_2:1638156_at:24:251; Interrogation_Position=1560; Antisense; CAATGAGATTCCTTGCGCAACGCAT
>probe:Drosophila_2:1638156_at:482:135; Interrogation_Position=1579; Antisense; ACGCATCCATGCTAATATACTCCAG
>probe:Drosophila_2:1638156_at:84:455; Interrogation_Position=1623; Antisense; GATACGATATTTCTTTCTAAGCCTA
>probe:Drosophila_2:1638156_at:124:461; Interrogation_Position=1654; Antisense; GATTTTTGTTACTACTTTTCCATGA
>probe:Drosophila_2:1638156_at:500:53; Interrogation_Position=1801; Antisense; ATGACTTACAATTCCGTCCTTACAA

Paste this into a BLAST search page for me
AGTCGGCGAGTGTCAAGCGCATCATAGCGCATCATTGTGGGCGATCTACAGATCTACAGCGCTTGGACATTCTAAGCAGTCCACCAATTTGAAACCCAGTGAAACCCAGTCGTCCAGCAATAAAAAGTGGACCAATATAGCTGCTCGGACCTACCACAAGTGCTATGCCCATATGGAGCTGGGCAATGTCATATTCTTGTATATTCTTGTTGTTTGTGGCAGCGGCAATGAGATTCCTTGCGCAACGCATACGCATCCATGCTAATATACTCCAGGATACGATATTTCTTTCTAAGCCTAGATTTTTGTTACTACTTTTCCATGAATGACTTACAATTCCGTCCTTACAA

Full Affymetrix probeset data:

Annotations for 1638156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720