Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638157_at:

>probe:Drosophila_2:1638157_at:348:605; Interrogation_Position=1067; Antisense; TGATCACGCCCTGGCTAGAGATCGA
>probe:Drosophila_2:1638157_at:719:675; Interrogation_Position=1082; Antisense; TAGAGATCGAGGACTACCCCACTGT
>probe:Drosophila_2:1638157_at:354:413; Interrogation_Position=1159; Antisense; GACCTGCCCATGAAGGTGGTCGACA
>probe:Drosophila_2:1638157_at:374:323; Interrogation_Position=1208; Antisense; GCGCCTACGATTTCAAGTGCCTGGA
>probe:Drosophila_2:1638157_at:101:109; Interrogation_Position=1253; Antisense; AGAATGGCTTCGTGTTTGGCGACCA
>probe:Drosophila_2:1638157_at:126:583; Interrogation_Position=1269; Antisense; TGGCGACCATGTTCAGCTGGCCGAG
>probe:Drosophila_2:1638157_at:498:419; Interrogation_Position=1291; Antisense; GAGCAGCTGAGGATTTGGTTCGAAA
>probe:Drosophila_2:1638157_at:92:699; Interrogation_Position=1317; Antisense; TTTTCCAAAGAATCCCAGCATCCTG
>probe:Drosophila_2:1638157_at:680:345; Interrogation_Position=1334; Antisense; GCATCCTGGAGACAAGAGCTGGTTT
>probe:Drosophila_2:1638157_at:449:695; Interrogation_Position=1357; Antisense; TTTCAGCGCAAAATCCAGGAGTTCC
>probe:Drosophila_2:1638157_at:201:301; Interrogation_Position=1422; Antisense; CCCCGTACTGGAGGCATTTCTATAG
>probe:Drosophila_2:1638157_at:400:425; Interrogation_Position=1482; Antisense; GAGAGACTTCCTTTGATTGCTAATC
>probe:Drosophila_2:1638157_at:250:339; Interrogation_Position=1500; Antisense; GCTAATCGCTTTTTCTAGGCTAGTT
>probe:Drosophila_2:1638157_at:85:419; Interrogation_Position=1547; Antisense; GAGCTTCAAACTTGCTTATGATGCT

Paste this into a BLAST search page for me
TGATCACGCCCTGGCTAGAGATCGATAGAGATCGAGGACTACCCCACTGTGACCTGCCCATGAAGGTGGTCGACAGCGCCTACGATTTCAAGTGCCTGGAAGAATGGCTTCGTGTTTGGCGACCATGGCGACCATGTTCAGCTGGCCGAGGAGCAGCTGAGGATTTGGTTCGAAATTTTCCAAAGAATCCCAGCATCCTGGCATCCTGGAGACAAGAGCTGGTTTTTTCAGCGCAAAATCCAGGAGTTCCCCCCGTACTGGAGGCATTTCTATAGGAGAGACTTCCTTTGATTGCTAATCGCTAATCGCTTTTTCTAGGCTAGTTGAGCTTCAAACTTGCTTATGATGCT

Full Affymetrix probeset data:

Annotations for 1638157_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime