Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638158_at:

>probe:Drosophila_2:1638158_at:646:123; Interrogation_Position=2954; Antisense; AGCGCAGCCAGATGTTGCAGGAGCT
>probe:Drosophila_2:1638158_at:387:111; Interrogation_Position=2993; Antisense; AGCACAAGTTTGAGGCCTGCGACAC
>probe:Drosophila_2:1638158_at:468:397; Interrogation_Position=3013; Antisense; GACACGGCCATACGCTCCTGGAAGG
>probe:Drosophila_2:1638158_at:291:413; Interrogation_Position=3055; Antisense; GACCTCAGCTCCTTTATGTCTGACA
>probe:Drosophila_2:1638158_at:317:61; Interrogation_Position=3070; Antisense; ATGTCTGACATGTCGCTGAAGCCGG
>probe:Drosophila_2:1638158_at:710:145; Interrogation_Position=3140; Antisense; ACTCGCACGAGCTGATGGTCACCGA
>probe:Drosophila_2:1638158_at:244:91; Interrogation_Position=3206; Antisense; AGTAGATGCTTCTTTGCTGTGCAAA
>probe:Drosophila_2:1638158_at:716:595; Interrogation_Position=3223; Antisense; TGTGCAAAGGCCATCAGCCAGCCAG
>probe:Drosophila_2:1638158_at:179:629; Interrogation_Position=3328; Antisense; TCCTCCTACACTACAATTATCTCGA
>probe:Drosophila_2:1638158_at:604:15; Interrogation_Position=3343; Antisense; ATTATCTCGAACACCAGCGCCAAGT
>probe:Drosophila_2:1638158_at:49:125; Interrogation_Position=3358; Antisense; AGCGCCAAGTCAGCACTTATCAATC
>probe:Drosophila_2:1638158_at:183:687; Interrogation_Position=3375; Antisense; TATCAATCACTTTTCGGCATTTCCC
>probe:Drosophila_2:1638158_at:490:345; Interrogation_Position=3391; Antisense; GCATTTCCCTCGTACAACACATAAA
>probe:Drosophila_2:1638158_at:210:171; Interrogation_Position=3466; Antisense; AAAGATTGCGTACCGCTTTGCAAGT

Paste this into a BLAST search page for me
AGCGCAGCCAGATGTTGCAGGAGCTAGCACAAGTTTGAGGCCTGCGACACGACACGGCCATACGCTCCTGGAAGGGACCTCAGCTCCTTTATGTCTGACAATGTCTGACATGTCGCTGAAGCCGGACTCGCACGAGCTGATGGTCACCGAAGTAGATGCTTCTTTGCTGTGCAAATGTGCAAAGGCCATCAGCCAGCCAGTCCTCCTACACTACAATTATCTCGAATTATCTCGAACACCAGCGCCAAGTAGCGCCAAGTCAGCACTTATCAATCTATCAATCACTTTTCGGCATTTCCCGCATTTCCCTCGTACAACACATAAAAAAGATTGCGTACCGCTTTGCAAGT

Full Affymetrix probeset data:

Annotations for 1638158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime