FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638160_at:

>probe:Drosophila_2:1638160_at:168:609; Interrogation_Position=101; Antisense; TGACGCTCCATGGTGCTCCAATAAA
>probe:Drosophila_2:1638160_at:723:499; Interrogation_Position=148; Antisense; GTCGTTTCTCAGACGTTGTTGTACA
>probe:Drosophila_2:1638160_at:254:155; Interrogation_Position=170; Antisense; ACAGAATTTGCATGTCCTGCCAGTC
>probe:Drosophila_2:1638160_at:12:503; Interrogation_Position=192; Antisense; GTCCGACGCTCTCAAAACTCAAAAT
>probe:Drosophila_2:1638160_at:487:659; Interrogation_Position=227; Antisense; TAACGCCAAGTTTTTTATCCGGCTG
>probe:Drosophila_2:1638160_at:726:151; Interrogation_Position=26; Antisense; ACATCAATGTCGGTGGCTCTGGCGT
>probe:Drosophila_2:1638160_at:68:159; Interrogation_Position=295; Antisense; ACACAAATACTAGACGGCGGCGGCG
>probe:Drosophila_2:1638160_at:487:331; Interrogation_Position=326; Antisense; GCGGCACAACGCCATGTTGGATTAT
>probe:Drosophila_2:1638160_at:307:543; Interrogation_Position=344; Antisense; GGATTATTCAACTCGACGCCATTTC
>probe:Drosophila_2:1638160_at:51:573; Interrogation_Position=40; Antisense; GGCTCTGGCGTGCTATTTGAATTGA
>probe:Drosophila_2:1638160_at:33:567; Interrogation_Position=418; Antisense; GGCACACGGCTGTGGCAACAACTAA
>probe:Drosophila_2:1638160_at:173:147; Interrogation_Position=438; Antisense; ACTAAAACGGTACCTGCTGCAGCAG
>probe:Drosophila_2:1638160_at:504:287; Interrogation_Position=481; Antisense; CTGGAACAGCAGGACTACGGACTAA
>probe:Drosophila_2:1638160_at:278:417; Interrogation_Position=562; Antisense; GAGCGTGGGCGCAAAGTCTCAGCTA

Paste this into a BLAST search page for me
TGACGCTCCATGGTGCTCCAATAAAGTCGTTTCTCAGACGTTGTTGTACAACAGAATTTGCATGTCCTGCCAGTCGTCCGACGCTCTCAAAACTCAAAATTAACGCCAAGTTTTTTATCCGGCTGACATCAATGTCGGTGGCTCTGGCGTACACAAATACTAGACGGCGGCGGCGGCGGCACAACGCCATGTTGGATTATGGATTATTCAACTCGACGCCATTTCGGCTCTGGCGTGCTATTTGAATTGAGGCACACGGCTGTGGCAACAACTAAACTAAAACGGTACCTGCTGCAGCAGCTGGAACAGCAGGACTACGGACTAAGAGCGTGGGCGCAAAGTCTCAGCTA

Full Affymetrix probeset data:

Annotations for 1638160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720