FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638161_at:

>probe:Drosophila_2:1638161_at:543:561; Interrogation_Position=1237; Antisense; GGAACTGCCGTTTGAGGCGATGCCT
>probe:Drosophila_2:1638161_at:461:413; Interrogation_Position=1274; Antisense; GACCTCACCAGCGATGTCAGGGAAT
>probe:Drosophila_2:1638161_at:116:267; Interrogation_Position=1291; Antisense; CAGGGAATGTTACGGCTGCGCCAAA
>probe:Drosophila_2:1638161_at:432:79; Interrogation_Position=1338; Antisense; AGGTCGCCGATAAAGTCGTCTTCAG
>probe:Drosophila_2:1638161_at:263:639; Interrogation_Position=1353; Antisense; TCGTCTTCAGATGCGGTTTCTGCAA
>probe:Drosophila_2:1638161_at:440:479; Interrogation_Position=1368; Antisense; GTTTCTGCAAGCAGTTCTTCTGCGT
>probe:Drosophila_2:1638161_at:12:713; Interrogation_Position=1385; Antisense; TTCTGCGTTGACTGCGACATCTTCA
>probe:Drosophila_2:1638161_at:515:401; Interrogation_Position=1400; Antisense; GACATCTTCATTCACGACACATTGC
>probe:Drosophila_2:1638161_at:523:133; Interrogation_Position=1425; Antisense; ACGCCTGCGTGGGATGCAACACCAT
>probe:Drosophila_2:1638161_at:397:535; Interrogation_Position=1468; Antisense; GGTTTACCAGCAAAGTTCCAAGTCT
>probe:Drosophila_2:1638161_at:469:609; Interrogation_Position=1492; Antisense; TGACCAGGTTGATGCACACCCAGGG
>probe:Drosophila_2:1638161_at:275:517; Interrogation_Position=1537; Antisense; GTGTGGGATGTAACTGACTTTCTAT
>probe:Drosophila_2:1638161_at:71:717; Interrogation_Position=1572; Antisense; TTCGAACTTCCACATAACTACGCAT
>probe:Drosophila_2:1638161_at:480:15; Interrogation_Position=1699; Antisense; ATTATGGCCGTTGTGTGAGACCCTC

Paste this into a BLAST search page for me
GGAACTGCCGTTTGAGGCGATGCCTGACCTCACCAGCGATGTCAGGGAATCAGGGAATGTTACGGCTGCGCCAAAAGGTCGCCGATAAAGTCGTCTTCAGTCGTCTTCAGATGCGGTTTCTGCAAGTTTCTGCAAGCAGTTCTTCTGCGTTTCTGCGTTGACTGCGACATCTTCAGACATCTTCATTCACGACACATTGCACGCCTGCGTGGGATGCAACACCATGGTTTACCAGCAAAGTTCCAAGTCTTGACCAGGTTGATGCACACCCAGGGGTGTGGGATGTAACTGACTTTCTATTTCGAACTTCCACATAACTACGCATATTATGGCCGTTGTGTGAGACCCTC

Full Affymetrix probeset data:

Annotations for 1638161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720