FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638164_at:

>probe:Drosophila_2:1638164_at:363:707; Interrogation_Position=1037; Antisense; TTACGCTGTAAATTGAGTTTCCCCG
>probe:Drosophila_2:1638164_at:584:377; Interrogation_Position=1055; Antisense; TTCCCCGTTAAATGCCTTCAAGACT
>probe:Drosophila_2:1638164_at:402:89; Interrogation_Position=1125; Antisense; AGTCAACAGCTAATCCATATCCAAA
>probe:Drosophila_2:1638164_at:359:157; Interrogation_Position=1175; Antisense; ACACTTATGCGATACGATGTCTATA
>probe:Drosophila_2:1638164_at:54:83; Interrogation_Position=688; Antisense; AGGGATCTGATCACCACACAGCAAA
>probe:Drosophila_2:1638164_at:727:111; Interrogation_Position=707; Antisense; AGCAAAGGGAACACGCCCAGCAGCT
>probe:Drosophila_2:1638164_at:269:117; Interrogation_Position=728; Antisense; AGCTGAACCGCGAATTTAGTAACTT
>probe:Drosophila_2:1638164_at:344:191; Interrogation_Position=748; Antisense; AACTTCCGTAGCGATCTGGATGCCA
>probe:Drosophila_2:1638164_at:17:547; Interrogation_Position=765; Antisense; GGATGCCATTAAGGGCCTGCTTTTG
>probe:Drosophila_2:1638164_at:706:521; Interrogation_Position=777; Antisense; GGGCCTGCTTTTGAACCGAAAACAG
>probe:Drosophila_2:1638164_at:216:35; Interrogation_Position=875; Antisense; ATCACCGGCACAGCGGGTCGGACGA
>probe:Drosophila_2:1638164_at:195:637; Interrogation_Position=937; Antisense; TCGTCGGAGACAGAGGTGGTCACCA
>probe:Drosophila_2:1638164_at:373:629; Interrogation_Position=973; Antisense; TCCAGCTTGGAGATCATGTAATGCA
>probe:Drosophila_2:1638164_at:534:33; Interrogation_Position=998; Antisense; ATCAGAATACGAGGCTGGCTATATA

Paste this into a BLAST search page for me
TTACGCTGTAAATTGAGTTTCCCCGTTCCCCGTTAAATGCCTTCAAGACTAGTCAACAGCTAATCCATATCCAAAACACTTATGCGATACGATGTCTATAAGGGATCTGATCACCACACAGCAAAAGCAAAGGGAACACGCCCAGCAGCTAGCTGAACCGCGAATTTAGTAACTTAACTTCCGTAGCGATCTGGATGCCAGGATGCCATTAAGGGCCTGCTTTTGGGGCCTGCTTTTGAACCGAAAACAGATCACCGGCACAGCGGGTCGGACGATCGTCGGAGACAGAGGTGGTCACCATCCAGCTTGGAGATCATGTAATGCAATCAGAATACGAGGCTGGCTATATA

Full Affymetrix probeset data:

Annotations for 1638164_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720