FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638166_at:

>probe:Drosophila_2:1638166_at:110:273; Interrogation_Position=115; Antisense; CATTGGCAACAAGTGGGAGTCGTAT
>probe:Drosophila_2:1638166_at:232:689; Interrogation_Position=139; Antisense; TTTGGGTCTCCTGCAAGCGGAATAC
>probe:Drosophila_2:1638166_at:497:241; Interrogation_Position=159; Antisense; AATACACCGAAGGAGATGCCCTGGA
>probe:Drosophila_2:1638166_at:328:51; Interrogation_Position=174; Antisense; ATGCCCTGGATGCTTTGGGTCTAAA
>probe:Drosophila_2:1638166_at:241:663; Interrogation_Position=195; Antisense; TAAAGAGGTACTGCTGCCGTCGCAT
>probe:Drosophila_2:1638166_at:188:595; Interrogation_Position=225; Antisense; TGGGCCACGTGGATCTTATCGAAAA
>probe:Drosophila_2:1638166_at:402:389; Interrogation_Position=245; Antisense; GAAAAACTGCTCAACTATGCTCCTC
>probe:Drosophila_2:1638166_at:708:513; Interrogation_Position=25; Antisense; GTGATTGCACATTTTTCGTGATTTA
>probe:Drosophila_2:1638166_at:411:337; Interrogation_Position=263; Antisense; GCTCCTCTGGAGAAGTGAACGGCAC
>probe:Drosophila_2:1638166_at:277:511; Interrogation_Position=277; Antisense; GTGAACGGCACAATGGAAACCATCC
>probe:Drosophila_2:1638166_at:442:391; Interrogation_Position=292; Antisense; GAAACCATCCAAACTGGACTTGGGA
>probe:Drosophila_2:1638166_at:623:663; Interrogation_Position=352; Antisense; TAAAGCTTGATCGATAGCCCTAGAA
>probe:Drosophila_2:1638166_at:697:701; Interrogation_Position=81; Antisense; TTATTCCAATCCGTTGTTTCACCTG
>probe:Drosophila_2:1638166_at:250:697; Interrogation_Position=97; Antisense; TTTCACCTGCGGCAAGGTCATTGGC

Paste this into a BLAST search page for me
CATTGGCAACAAGTGGGAGTCGTATTTTGGGTCTCCTGCAAGCGGAATACAATACACCGAAGGAGATGCCCTGGAATGCCCTGGATGCTTTGGGTCTAAATAAAGAGGTACTGCTGCCGTCGCATTGGGCCACGTGGATCTTATCGAAAAGAAAAACTGCTCAACTATGCTCCTCGTGATTGCACATTTTTCGTGATTTAGCTCCTCTGGAGAAGTGAACGGCACGTGAACGGCACAATGGAAACCATCCGAAACCATCCAAACTGGACTTGGGATAAAGCTTGATCGATAGCCCTAGAATTATTCCAATCCGTTGTTTCACCTGTTTCACCTGCGGCAAGGTCATTGGC

Full Affymetrix probeset data:

Annotations for 1638166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720