FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638167_at:

>probe:Drosophila_2:1638167_at:512:401; Interrogation_Position=1133; Antisense; GACATCGATTGACCGCAGATAACTA
>probe:Drosophila_2:1638167_at:393:455; Interrogation_Position=1150; Antisense; GATAACTACTCTAAGCTTCGACTCT
>probe:Drosophila_2:1638167_at:382:117; Interrogation_Position=1163; Antisense; AGCTTCGACTCTTATTGCACGTAAT
>probe:Drosophila_2:1638167_at:685:257; Interrogation_Position=1180; Antisense; CACGTAATACTCCATCCTATCTTAT
>probe:Drosophila_2:1638167_at:487:677; Interrogation_Position=1211; Antisense; TAGTGCGTAATCTGCAGCTTTCTTC
>probe:Drosophila_2:1638167_at:262:341; Interrogation_Position=1227; Antisense; GCTTTCTTCCACAGAATATCTCGTA
>probe:Drosophila_2:1638167_at:556:429; Interrogation_Position=770; Antisense; TGAGTTCGGCTAGGAACCCTTATTC
>probe:Drosophila_2:1638167_at:65:571; Interrogation_Position=801; Antisense; GGCTCAATGCTCACGCAGAGATGCA
>probe:Drosophila_2:1638167_at:436:425; Interrogation_Position=818; Antisense; GAGATGCATTTTTACTGTTTCCTTT
>probe:Drosophila_2:1638167_at:645:115; Interrogation_Position=853; Antisense; AGCTTTCGGCTATGTTATGATTTTT
>probe:Drosophila_2:1638167_at:637:503; Interrogation_Position=918; Antisense; GTCCCGAACGCGAACACGAGTCATA
>probe:Drosophila_2:1638167_at:706:675; Interrogation_Position=952; Antisense; TAGTTTCTATTAACCAGGCGCCAAA
>probe:Drosophila_2:1638167_at:173:269; Interrogation_Position=966; Antisense; CAGGCGCCAAACATTAACCACTTAA
>probe:Drosophila_2:1638167_at:288:491; Interrogation_Position=996; Antisense; GTACACGTAAGCTAGGATGGCGGAT

Paste this into a BLAST search page for me
GACATCGATTGACCGCAGATAACTAGATAACTACTCTAAGCTTCGACTCTAGCTTCGACTCTTATTGCACGTAATCACGTAATACTCCATCCTATCTTATTAGTGCGTAATCTGCAGCTTTCTTCGCTTTCTTCCACAGAATATCTCGTATGAGTTCGGCTAGGAACCCTTATTCGGCTCAATGCTCACGCAGAGATGCAGAGATGCATTTTTACTGTTTCCTTTAGCTTTCGGCTATGTTATGATTTTTGTCCCGAACGCGAACACGAGTCATATAGTTTCTATTAACCAGGCGCCAAACAGGCGCCAAACATTAACCACTTAAGTACACGTAAGCTAGGATGGCGGAT

Full Affymetrix probeset data:

Annotations for 1638167_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720