Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638169_s_at:

>probe:Drosophila_2:1638169_s_at:398:147; Interrogation_Position=110; Antisense; ACTACTTGACGGACCAGCACTGGGA
>probe:Drosophila_2:1638169_s_at:726:413; Interrogation_Position=121; Antisense; GACCAGCACTGGGACGGCTTTTTAT
>probe:Drosophila_2:1638169_s_at:505:367; Interrogation_Position=133; Antisense; GACGGCTTTTTATCCGAAACGCTGA
>probe:Drosophila_2:1638169_s_at:676:297; Interrogation_Position=152; Antisense; CGCTGAAAAGTGAGATCGCCGGCAA
>probe:Drosophila_2:1638169_s_at:642:359; Interrogation_Position=173; Antisense; GCAAGGAAGATGTGGCTCTGGCCAT
>probe:Drosophila_2:1638169_s_at:661:33; Interrogation_Position=225; Antisense; ATCAGAAAGGTTTCCGGCATGGCGA
>probe:Drosophila_2:1638169_s_at:350:347; Interrogation_Position=241; Antisense; GCATGGCGAGAATTCCTAGGCAAGA
>probe:Drosophila_2:1638169_s_at:589:421; Interrogation_Position=264; Antisense; GAGCAAACAAGAACGCCTGTCGCTT
>probe:Drosophila_2:1638169_s_at:338:201; Interrogation_Position=275; Antisense; AACGCCTGTCGCTTCAGAGGGTCAG
>probe:Drosophila_2:1638169_s_at:136:617; Interrogation_Position=38; Antisense; TGCAGAGGCGTCTGGATGGCTTACT
>probe:Drosophila_2:1638169_s_at:209:589; Interrogation_Position=50; Antisense; TGGATGGCTTACTGGCCTTCCTCAA
>probe:Drosophila_2:1638169_s_at:360:629; Interrogation_Position=68; Antisense; TCCTCAATCCGCACTGGGATTTTGT
>probe:Drosophila_2:1638169_s_at:564:529; Interrogation_Position=83; Antisense; GGGATTTTGTCAATTGCCACATGGT
>probe:Drosophila_2:1638169_s_at:610:625; Interrogation_Position=97; Antisense; TGCCACATGGTGAACTACTTGACGG

Paste this into a BLAST search page for me
ACTACTTGACGGACCAGCACTGGGAGACCAGCACTGGGACGGCTTTTTATGACGGCTTTTTATCCGAAACGCTGACGCTGAAAAGTGAGATCGCCGGCAAGCAAGGAAGATGTGGCTCTGGCCATATCAGAAAGGTTTCCGGCATGGCGAGCATGGCGAGAATTCCTAGGCAAGAGAGCAAACAAGAACGCCTGTCGCTTAACGCCTGTCGCTTCAGAGGGTCAGTGCAGAGGCGTCTGGATGGCTTACTTGGATGGCTTACTGGCCTTCCTCAATCCTCAATCCGCACTGGGATTTTGTGGGATTTTGTCAATTGCCACATGGTTGCCACATGGTGAACTACTTGACGG

Full Affymetrix probeset data:

Annotations for 1638169_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime