Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638174_at:

>probe:Drosophila_2:1638174_at:351:15; Interrogation_Position=1095; Antisense; ATTTTCATTCCCTCGGAGCAGGGTG
>probe:Drosophila_2:1638174_at:526:549; Interrogation_Position=1152; Antisense; GGAGATCGCACCACTTTGCAATCGC
>probe:Drosophila_2:1638174_at:539:361; Interrogation_Position=1169; Antisense; GCAATCGCCGGTGATGGTGCTACCA
>probe:Drosophila_2:1638174_at:281:115; Interrogation_Position=1207; Antisense; AGCAGAGAGATGTTGTGTCCCCGCA
>probe:Drosophila_2:1638174_at:449:611; Interrogation_Position=1345; Antisense; TGACGTCGCCACTAAACAATCGCTA
>probe:Drosophila_2:1638174_at:100:427; Interrogation_Position=1374; Antisense; GAGATATATCCTGCTCCCGTAAATC
>probe:Drosophila_2:1638174_at:375:165; Interrogation_Position=1394; Antisense; AAATCCCCGCGTTAGCGAAGAGCTG
>probe:Drosophila_2:1638174_at:410:213; Interrogation_Position=1411; Antisense; AAGAGCTGCGCAACCAGATGCCTTG
>probe:Drosophila_2:1638174_at:702:97; Interrogation_Position=1426; Antisense; AGATGCCTTGGTCGTACACCAGCAT
>probe:Drosophila_2:1638174_at:197:149; Interrogation_Position=1487; Antisense; ACTTCAAGTACAGATCTACCCGCAG
>probe:Drosophila_2:1638174_at:301:563; Interrogation_Position=1517; Antisense; GGAACCCGACTACGCGGATCACTAG
>probe:Drosophila_2:1638174_at:510:497; Interrogation_Position=1541; Antisense; GTCATTATAGTAGTGCACGCTGCTC
>probe:Drosophila_2:1638174_at:678:619; Interrogation_Position=1561; Antisense; TGCTCGGGCGTTGATTTGCGTTTAA
>probe:Drosophila_2:1638174_at:411:35; Interrogation_Position=1585; Antisense; ATCAGTCTGGATGCGCGGTTGTAAA

Paste this into a BLAST search page for me
ATTTTCATTCCCTCGGAGCAGGGTGGGAGATCGCACCACTTTGCAATCGCGCAATCGCCGGTGATGGTGCTACCAAGCAGAGAGATGTTGTGTCCCCGCATGACGTCGCCACTAAACAATCGCTAGAGATATATCCTGCTCCCGTAAATCAAATCCCCGCGTTAGCGAAGAGCTGAAGAGCTGCGCAACCAGATGCCTTGAGATGCCTTGGTCGTACACCAGCATACTTCAAGTACAGATCTACCCGCAGGGAACCCGACTACGCGGATCACTAGGTCATTATAGTAGTGCACGCTGCTCTGCTCGGGCGTTGATTTGCGTTTAAATCAGTCTGGATGCGCGGTTGTAAA

Full Affymetrix probeset data:

Annotations for 1638174_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime