Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638175_at:

>probe:Drosophila_2:1638175_at:113:153; Interrogation_Position=1242; Antisense; ACATCCTACGTGGTGCAATCAGTGA
>probe:Drosophila_2:1638175_at:595:237; Interrogation_Position=1258; Antisense; AATCAGTGACGGCTCGTGGCATTCC
>probe:Drosophila_2:1638175_at:239:453; Interrogation_Position=1320; Antisense; GATCAACTTCGGATGGCTGCCTATA
>probe:Drosophila_2:1638175_at:114:681; Interrogation_Position=1364; Antisense; TATGCTGCAGCTATACTACCAGTGC
>probe:Drosophila_2:1638175_at:251:563; Interrogation_Position=1398; Antisense; GGAAGTGTTACAAATGCGGCAGCCA
>probe:Drosophila_2:1638175_at:584:157; Interrogation_Position=1440; Antisense; ACACAGCTACCTTTTCCTTATGAAA
>probe:Drosophila_2:1638175_at:166:479; Interrogation_Position=1466; Antisense; GTTTGCAGCCGGTATATCACGCGAT
>probe:Drosophila_2:1638175_at:251:485; Interrogation_Position=1528; Antisense; GTAGTCGTGTGGATTCGGCACCCAT
>probe:Drosophila_2:1638175_at:711:251; Interrogation_Position=1577; Antisense; CAAGCTGGGCGAGCATCTGGACAAT
>probe:Drosophila_2:1638175_at:169:237; Interrogation_Position=1612; Antisense; AATCGCATCGAGTGCAGCTGGCCAA
>probe:Drosophila_2:1638175_at:710:467; Interrogation_Position=1637; Antisense; GTTGCAAGCGTACTCTAATTCTGGA
>probe:Drosophila_2:1638175_at:458:55; Interrogation_Position=1672; Antisense; ATGAGTACGATACGGCGCTGGATCA
>probe:Drosophila_2:1638175_at:228:545; Interrogation_Position=1691; Antisense; GGATCAGCTGCTTGAGTTCCGCGAC
>probe:Drosophila_2:1638175_at:342:277; Interrogation_Position=1716; Antisense; CTTTACGCAGACTCGCAGTATCTAT

Paste this into a BLAST search page for me
ACATCCTACGTGGTGCAATCAGTGAAATCAGTGACGGCTCGTGGCATTCCGATCAACTTCGGATGGCTGCCTATATATGCTGCAGCTATACTACCAGTGCGGAAGTGTTACAAATGCGGCAGCCAACACAGCTACCTTTTCCTTATGAAAGTTTGCAGCCGGTATATCACGCGATGTAGTCGTGTGGATTCGGCACCCATCAAGCTGGGCGAGCATCTGGACAATAATCGCATCGAGTGCAGCTGGCCAAGTTGCAAGCGTACTCTAATTCTGGAATGAGTACGATACGGCGCTGGATCAGGATCAGCTGCTTGAGTTCCGCGACCTTTACGCAGACTCGCAGTATCTAT

Full Affymetrix probeset data:

Annotations for 1638175_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime