Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638176_at:

>probe:Drosophila_2:1638176_at:648:567; Interrogation_Position=4833; Antisense; GGCAGCTATTTGGAGCGACCCAGTA
>probe:Drosophila_2:1638176_at:617:661; Interrogation_Position=4856; Antisense; TAACAATATCTCAGCCACTTTGGCG
>probe:Drosophila_2:1638176_at:157:347; Interrogation_Position=4883; Antisense; GCATCAGCAGCCACAATTATGACTC
>probe:Drosophila_2:1638176_at:355:683; Interrogation_Position=4900; Antisense; TATGACTCTGAGACCTACGCATTCG
>probe:Drosophila_2:1638176_at:618:413; Interrogation_Position=4911; Antisense; GACCTACGCATTCGGCTCTATAAGA
>probe:Drosophila_2:1638176_at:508:419; Interrogation_Position=4934; Antisense; GAGCTTTCTATAGTGTTGCATCGCC
>probe:Drosophila_2:1638176_at:655:329; Interrogation_Position=4960; Antisense; GCAGGCCCTTAGTTTGTACTTTCGT
>probe:Drosophila_2:1638176_at:379:695; Interrogation_Position=4979; Antisense; TTTCGTTAGCAAAGTACTCACCCCA
>probe:Drosophila_2:1638176_at:566:89; Interrogation_Position=4991; Antisense; AGTACTCACCCCAAAGACTGAATTT
>probe:Drosophila_2:1638176_at:130:487; Interrogation_Position=5017; Antisense; GTAGCATATGTAAGCCAAACCCTTT
>probe:Drosophila_2:1638176_at:353:307; Interrogation_Position=5030; Antisense; GCCAAACCCTTTGCAAGTCTCAAAA
>probe:Drosophila_2:1638176_at:274:597; Interrogation_Position=5060; Antisense; TGTGAGTGCGTATTTTATTCCAGTT
>probe:Drosophila_2:1638176_at:402:457; Interrogation_Position=5091; Antisense; GATACCGATCATTATCTTAGGCTAA
>probe:Drosophila_2:1638176_at:223:277; Interrogation_Position=5106; Antisense; CTTAGGCTAAGTTACTGCTTGTACT

Paste this into a BLAST search page for me
GGCAGCTATTTGGAGCGACCCAGTATAACAATATCTCAGCCACTTTGGCGGCATCAGCAGCCACAATTATGACTCTATGACTCTGAGACCTACGCATTCGGACCTACGCATTCGGCTCTATAAGAGAGCTTTCTATAGTGTTGCATCGCCGCAGGCCCTTAGTTTGTACTTTCGTTTTCGTTAGCAAAGTACTCACCCCAAGTACTCACCCCAAAGACTGAATTTGTAGCATATGTAAGCCAAACCCTTTGCCAAACCCTTTGCAAGTCTCAAAATGTGAGTGCGTATTTTATTCCAGTTGATACCGATCATTATCTTAGGCTAACTTAGGCTAAGTTACTGCTTGTACT

Full Affymetrix probeset data:

Annotations for 1638176_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime