Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638178_at:

>probe:Drosophila_2:1638178_at:610:601; Interrogation_Position=100; Antisense; TGTTCCTTTCGTTATTTTTCCACTG
>probe:Drosophila_2:1638178_at:468:17; Interrogation_Position=113; Antisense; ATTTTTCCACTGCACAGGACTGGTC
>probe:Drosophila_2:1638178_at:642:209; Interrogation_Position=151; Antisense; AAGCAAGACCGGATTCGCTTCTCTT
>probe:Drosophila_2:1638178_at:229:275; Interrogation_Position=168; Antisense; CTTCTCTTCTTACTTATCGCCATAA
>probe:Drosophila_2:1638178_at:588:371; Interrogation_Position=215; Antisense; GAAGTACGGGCCAATTCTTCCAGAA
>probe:Drosophila_2:1638178_at:100:661; Interrogation_Position=244; Antisense; TAACGGGAGCAATCCTCGAGGTTCC
>probe:Drosophila_2:1638178_at:300:433; Interrogation_Position=261; Antisense; GAGGTTCCGGTCCTATGTTTGGCTC
>probe:Drosophila_2:1638178_at:294:65; Interrogation_Position=335; Antisense; ATGGTTGGTGGATTCTGCCAGCAGA
>probe:Drosophila_2:1638178_at:283:231; Interrogation_Position=378; Antisense; AATGAGCAACTCTCCTTGATGGTAA
>probe:Drosophila_2:1638178_at:289:459; Interrogation_Position=405; Antisense; GATATCACTCCGCTTATACTGACAA
>probe:Drosophila_2:1638178_at:550:237; Interrogation_Position=448; Antisense; AATCGGCTGTGTTTCTCAACTGTTT
>probe:Drosophila_2:1638178_at:524:225; Interrogation_Position=507; Antisense; AAGGAAGACTGCGTCACACCCAGTG
>probe:Drosophila_2:1638178_at:344:157; Interrogation_Position=522; Antisense; ACACCCAGTGTCCTTTCATTTATAG
>probe:Drosophila_2:1638178_at:343:437; Interrogation_Position=78; Antisense; GAGGCATCGTTTATGGTTGCCCTGT

Paste this into a BLAST search page for me
TGTTCCTTTCGTTATTTTTCCACTGATTTTTCCACTGCACAGGACTGGTCAAGCAAGACCGGATTCGCTTCTCTTCTTCTCTTCTTACTTATCGCCATAAGAAGTACGGGCCAATTCTTCCAGAATAACGGGAGCAATCCTCGAGGTTCCGAGGTTCCGGTCCTATGTTTGGCTCATGGTTGGTGGATTCTGCCAGCAGAAATGAGCAACTCTCCTTGATGGTAAGATATCACTCCGCTTATACTGACAAAATCGGCTGTGTTTCTCAACTGTTTAAGGAAGACTGCGTCACACCCAGTGACACCCAGTGTCCTTTCATTTATAGGAGGCATCGTTTATGGTTGCCCTGT

Full Affymetrix probeset data:

Annotations for 1638178_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime