FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638179_at:

>probe:Drosophila_2:1638179_at:158:587; Interrogation_Position=230; Antisense; TGGACGTTATCTACTGGTCACGCCA
>probe:Drosophila_2:1638179_at:247:689; Interrogation_Position=257; Antisense; TATTCGGCATCTTTCTGGGCGTCAT
>probe:Drosophila_2:1638179_at:8:569; Interrogation_Position=286; Antisense; GGCATTGTTCCGCTGAAGGGCTTTC
>probe:Drosophila_2:1638179_at:10:373; Interrogation_Position=300; Antisense; GAAGGGCTTTCTGGGCCTCGTACTA
>probe:Drosophila_2:1638179_at:338:545; Interrogation_Position=344; Antisense; GGATCGTCTACCTGTACGCCATAAA
>probe:Drosophila_2:1638179_at:62:471; Interrogation_Position=426; Antisense; GTTCATGACGTCGTTTGCCGGATTC
>probe:Drosophila_2:1638179_at:386:591; Interrogation_Position=452; Antisense; TGGTCACGTGGATCATCTTCTACAC
>probe:Drosophila_2:1638179_at:578:77; Interrogation_Position=510; Antisense; AGGATCTTAATAACACTCCCCAGCA
>probe:Drosophila_2:1638179_at:632:239; Interrogation_Position=534; Antisense; AATACCGGATTCCAGGAGCCAGGTC
>probe:Drosophila_2:1638179_at:543:503; Interrogation_Position=611; Antisense; GTCCCCTTTGTACTCGCTGTAGATT
>probe:Drosophila_2:1638179_at:645:343; Interrogation_Position=669; Antisense; GCATTTCTGTTGTGACCGATTGTCC
>probe:Drosophila_2:1638179_at:15:465; Interrogation_Position=686; Antisense; GATTGTCCCGAATCTTTCCGTGAAA
>probe:Drosophila_2:1638179_at:527:693; Interrogation_Position=700; Antisense; TTTCCGTGAAAGATCCTTCGGCCAG
>probe:Drosophila_2:1638179_at:236:631; Interrogation_Position=717; Antisense; TCGGCCAGCGGTCTTAGTTGAAAAC

Paste this into a BLAST search page for me
TGGACGTTATCTACTGGTCACGCCATATTCGGCATCTTTCTGGGCGTCATGGCATTGTTCCGCTGAAGGGCTTTCGAAGGGCTTTCTGGGCCTCGTACTAGGATCGTCTACCTGTACGCCATAAAGTTCATGACGTCGTTTGCCGGATTCTGGTCACGTGGATCATCTTCTACACAGGATCTTAATAACACTCCCCAGCAAATACCGGATTCCAGGAGCCAGGTCGTCCCCTTTGTACTCGCTGTAGATTGCATTTCTGTTGTGACCGATTGTCCGATTGTCCCGAATCTTTCCGTGAAATTTCCGTGAAAGATCCTTCGGCCAGTCGGCCAGCGGTCTTAGTTGAAAAC

Full Affymetrix probeset data:

Annotations for 1638179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720