FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638181_at:

>probe:Drosophila_2:1638181_at:657:589; Interrogation_Position=1162; Antisense; TGGTCACTACTGGTAACGATGCCCC
>probe:Drosophila_2:1638181_at:2:51; Interrogation_Position=1180; Antisense; ATGCCCCTGGCAATAGTTGTATTCT
>probe:Drosophila_2:1638181_at:515:25; Interrogation_Position=1192; Antisense; ATAGTTGTATTCTTGCACTCTCGCA
>probe:Drosophila_2:1638181_at:356:17; Interrogation_Position=1230; Antisense; ATTTTATCACTCGTCTTACTGCGCG
>probe:Drosophila_2:1638181_at:302:611; Interrogation_Position=1395; Antisense; TGACTTAATAGCCTACGCACATCTC
>probe:Drosophila_2:1638181_at:719:271; Interrogation_Position=1455; Antisense; CATCATCGGTGGTTCTGTTTATAGT
>probe:Drosophila_2:1638181_at:301:229; Interrogation_Position=1489; Antisense; AATGTGGGCATCGAATTGGTCTTAC
>probe:Drosophila_2:1638181_at:13:635; Interrogation_Position=1511; Antisense; TACAGAAGAAACTCAACTCCCGCGG
>probe:Drosophila_2:1638181_at:296:189; Interrogation_Position=1525; Antisense; AACTCCCGCGGTCAAGTAGTCTTGT
>probe:Drosophila_2:1638181_at:84:449; Interrogation_Position=1643; Antisense; GATCCGCTGGGCTGTTCATGTGGTC
>probe:Drosophila_2:1638181_at:514:61; Interrogation_Position=1660; Antisense; ATGTGGTCCCTATTCGTGTTGTTCC
>probe:Drosophila_2:1638181_at:107:469; Interrogation_Position=1680; Antisense; GTTCCTAGTTTACACTACGGCCATA
>probe:Drosophila_2:1638181_at:414:517; Interrogation_Position=1713; Antisense; GTGGGTCCATGGCTTCCAAGACAAT
>probe:Drosophila_2:1638181_at:140:107; Interrogation_Position=1731; Antisense; AGACAATATTCAGATTCGCCCGACT

Paste this into a BLAST search page for me
TGGTCACTACTGGTAACGATGCCCCATGCCCCTGGCAATAGTTGTATTCTATAGTTGTATTCTTGCACTCTCGCAATTTTATCACTCGTCTTACTGCGCGTGACTTAATAGCCTACGCACATCTCCATCATCGGTGGTTCTGTTTATAGTAATGTGGGCATCGAATTGGTCTTACTACAGAAGAAACTCAACTCCCGCGGAACTCCCGCGGTCAAGTAGTCTTGTGATCCGCTGGGCTGTTCATGTGGTCATGTGGTCCCTATTCGTGTTGTTCCGTTCCTAGTTTACACTACGGCCATAGTGGGTCCATGGCTTCCAAGACAATAGACAATATTCAGATTCGCCCGACT

Full Affymetrix probeset data:

Annotations for 1638181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720