FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638182_at:

>probe:Drosophila_2:1638182_at:212:685; Interrogation_Position=1011; Antisense; TATTCTTTACTCGAAGTGGCTTCCG
>probe:Drosophila_2:1638182_at:455:73; Interrogation_Position=1037; Antisense; AGGACGATATTCTGGCCCACCCAAA
>probe:Drosophila_2:1638182_at:36:209; Interrogation_Position=1066; Antisense; AAGCTATTCATCAACCACGCCGGAA
>probe:Drosophila_2:1638182_at:112:171; Interrogation_Position=1090; Antisense; AAAGGTGGCATTACTGAGTCCCAGT
>probe:Drosophila_2:1638182_at:573:431; Interrogation_Position=1105; Antisense; GAGTCCCAGTACCATGGAAAGCCCA
>probe:Drosophila_2:1638182_at:48:719; Interrogation_Position=1134; Antisense; TTCGCTGCCAGTCTTTGCTGACCAG
>probe:Drosophila_2:1638182_at:664:621; Interrogation_Position=1149; Antisense; TGCTGACCAGCCACGTAACGCAAAT
>probe:Drosophila_2:1638182_at:11:253; Interrogation_Position=1169; Antisense; CAAATGCCATGGTCAAAAGCGGTTT
>probe:Drosophila_2:1638182_at:380:183; Interrogation_Position=1183; Antisense; AAAAGCGGTTTTGGCCTCACTCTGA
>probe:Drosophila_2:1638182_at:392:279; Interrogation_Position=1213; Antisense; CTCACTTTGGAGGAGAAGCCGTTTC
>probe:Drosophila_2:1638182_at:459:123; Interrogation_Position=1229; Antisense; AGCCGTTTCAAGAGGCCATCCTGGA
>probe:Drosophila_2:1638182_at:397:529; Interrogation_Position=1283; Antisense; GGGTGAAGTCCTTTTCAACTCTCTA
>probe:Drosophila_2:1638182_at:248:561; Interrogation_Position=1332; Antisense; GGAATCATTCCTCTACTGGACGGAG
>probe:Drosophila_2:1638182_at:518:109; Interrogation_Position=1510; Antisense; AGAAGATTCATCTCGAAGCCAAAGA

Paste this into a BLAST search page for me
TATTCTTTACTCGAAGTGGCTTCCGAGGACGATATTCTGGCCCACCCAAAAAGCTATTCATCAACCACGCCGGAAAAAGGTGGCATTACTGAGTCCCAGTGAGTCCCAGTACCATGGAAAGCCCATTCGCTGCCAGTCTTTGCTGACCAGTGCTGACCAGCCACGTAACGCAAATCAAATGCCATGGTCAAAAGCGGTTTAAAAGCGGTTTTGGCCTCACTCTGACTCACTTTGGAGGAGAAGCCGTTTCAGCCGTTTCAAGAGGCCATCCTGGAGGGTGAAGTCCTTTTCAACTCTCTAGGAATCATTCCTCTACTGGACGGAGAGAAGATTCATCTCGAAGCCAAAGA

Full Affymetrix probeset data:

Annotations for 1638182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720