Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638183_at:

>probe:Drosophila_2:1638183_at:169:297; Interrogation_Position=3332; Antisense; CGCTCTATATGGTAATCCCAACTGA
>probe:Drosophila_2:1638183_at:633:401; Interrogation_Position=3421; Antisense; GACTTCAATGTTTCGCTTAGGTTCT
>probe:Drosophila_2:1638183_at:78:335; Interrogation_Position=3435; Antisense; GCTTAGGTTCTTCTAATTTCAAACT
>probe:Drosophila_2:1638183_at:467:147; Interrogation_Position=3468; Antisense; ACTTATGCGCAACTATATAATGGCA
>probe:Drosophila_2:1638183_at:448:601; Interrogation_Position=3536; Antisense; TGTTGTACGAACATATTTCCGTTTA
>probe:Drosophila_2:1638183_at:43:233; Interrogation_Position=3569; Antisense; AATGCACTGTACTATTTCGGTTCAA
>probe:Drosophila_2:1638183_at:491:363; Interrogation_Position=3709; Antisense; GAATTTCGATATTTTTATGGCAGTG
>probe:Drosophila_2:1638183_at:664:349; Interrogation_Position=3728; Antisense; GCAGTGATATCGATTAGTTTGGTAA
>probe:Drosophila_2:1638183_at:639:477; Interrogation_Position=3744; Antisense; GTTTGGTAACAGTAGCTTAACATAG
>probe:Drosophila_2:1638183_at:180:659; Interrogation_Position=3789; Antisense; TAAGCTTAGCTCAACATTTAGGTAT
>probe:Drosophila_2:1638183_at:268:273; Interrogation_Position=3803; Antisense; CATTTAGGTATTTTTTGCACACGCA
>probe:Drosophila_2:1638183_at:164:693; Interrogation_Position=3816; Antisense; TTTGCACACGCAAACTCTGTTTCTC
>probe:Drosophila_2:1638183_at:652:357; Interrogation_Position=3825; Antisense; GCAAACTCTGTTTCTCTGTAATAAA
>probe:Drosophila_2:1638183_at:665:201; Interrogation_Position=3864; Antisense; AACCTCAGGTTTCTTATGATTTACA

Paste this into a BLAST search page for me
CGCTCTATATGGTAATCCCAACTGAGACTTCAATGTTTCGCTTAGGTTCTGCTTAGGTTCTTCTAATTTCAAACTACTTATGCGCAACTATATAATGGCATGTTGTACGAACATATTTCCGTTTAAATGCACTGTACTATTTCGGTTCAAGAATTTCGATATTTTTATGGCAGTGGCAGTGATATCGATTAGTTTGGTAAGTTTGGTAACAGTAGCTTAACATAGTAAGCTTAGCTCAACATTTAGGTATCATTTAGGTATTTTTTGCACACGCATTTGCACACGCAAACTCTGTTTCTCGCAAACTCTGTTTCTCTGTAATAAAAACCTCAGGTTTCTTATGATTTACA

Full Affymetrix probeset data:

Annotations for 1638183_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime