FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638184_at:

>probe:Drosophila_2:1638184_at:291:351; Interrogation_Position=135; Antisense; GCAGTTGTTGTTCAGCGAGCTCTTG
>probe:Drosophila_2:1638184_at:206:443; Interrogation_Position=172; Antisense; GATGATAACAACTACTACGGCGACC
>probe:Drosophila_2:1638184_at:483:141; Interrogation_Position=188; Antisense; ACGGCGACCAGTTGAAGTACCAGCA
>probe:Drosophila_2:1638184_at:269:435; Interrogation_Position=282; Antisense; GAGGGATCTGTTGCTCACCGTGGAC
>probe:Drosophila_2:1638184_at:46:407; Interrogation_Position=374; Antisense; GACTGCACAGGCTCGGCGATAATGG
>probe:Drosophila_2:1638184_at:639:435; Interrogation_Position=406; Antisense; GAGGAGCTGCGGTACAACGTCGTTA
>probe:Drosophila_2:1638184_at:139:475; Interrogation_Position=427; Antisense; GTTAACGAACTGACCAATATGCCCA
>probe:Drosophila_2:1638184_at:631:109; Interrogation_Position=455; Antisense; AGAAGGTGATGCCAGGACATCCCCT
>probe:Drosophila_2:1638184_at:470:197; Interrogation_Position=502; Antisense; AACGTTCAGTATATGTCGCCTTGCC
>probe:Drosophila_2:1638184_at:388:149; Interrogation_Position=527; Antisense; ACTTCAAGATCTGCAACATGGGACG
>probe:Drosophila_2:1638184_at:641:63; Interrogation_Position=544; Antisense; ATGGGACGCAAACGCAACGCTGGCT
>probe:Drosophila_2:1638184_at:15:253; Interrogation_Position=558; Antisense; CAACGCTGGCTTCAATTCCTACTGA
>probe:Drosophila_2:1638184_at:230:143; Interrogation_Position=59; Antisense; ACTGGGCCATTGTCATTGTGCTCCT
>probe:Drosophila_2:1638184_at:402:507; Interrogation_Position=76; Antisense; GTGCTCCTGTCAGTGGCGATTGGAC

Paste this into a BLAST search page for me
GCAGTTGTTGTTCAGCGAGCTCTTGGATGATAACAACTACTACGGCGACCACGGCGACCAGTTGAAGTACCAGCAGAGGGATCTGTTGCTCACCGTGGACGACTGCACAGGCTCGGCGATAATGGGAGGAGCTGCGGTACAACGTCGTTAGTTAACGAACTGACCAATATGCCCAAGAAGGTGATGCCAGGACATCCCCTAACGTTCAGTATATGTCGCCTTGCCACTTCAAGATCTGCAACATGGGACGATGGGACGCAAACGCAACGCTGGCTCAACGCTGGCTTCAATTCCTACTGAACTGGGCCATTGTCATTGTGCTCCTGTGCTCCTGTCAGTGGCGATTGGAC

Full Affymetrix probeset data:

Annotations for 1638184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720