FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638185_at:

>probe:Drosophila_2:1638185_at:605:623; Interrogation_Position=1026; Antisense; TGCCACTGTCAATGCCCCAAGGGAT
>probe:Drosophila_2:1638185_at:287:223; Interrogation_Position=1044; Antisense; AAGGGATCGGCGACCAGCAGCGACC
>probe:Drosophila_2:1638185_at:71:295; Interrogation_Position=1085; Antisense; CGAGCAGTTGACCTGTTGTCTTTTT
>probe:Drosophila_2:1638185_at:310:585; Interrogation_Position=1133; Antisense; TGGCACTGGTGCTCAAACGAACATA
>probe:Drosophila_2:1638185_at:396:193; Interrogation_Position=1157; Antisense; AACTCTTGTCCGGAATCACAGTCGA
>probe:Drosophila_2:1638185_at:201:35; Interrogation_Position=1171; Antisense; ATCACAGTCGATCGCAGAAGCCGCA
>probe:Drosophila_2:1638185_at:511:661; Interrogation_Position=1242; Antisense; TAAATAGCCGTAATCCCTTCAATCC
>probe:Drosophila_2:1638185_at:364:487; Interrogation_Position=1298; Antisense; GTACTTTGCCTATAGTTTCTGCTGC
>probe:Drosophila_2:1638185_at:664:715; Interrogation_Position=1314; Antisense; TTCTGCTGCAGTTACGAAACGGCGG
>probe:Drosophila_2:1638185_at:215:189; Interrogation_Position=1385; Antisense; AACAGAGCCGCTGAACGTGGAGTTC
>probe:Drosophila_2:1638185_at:387:99; Interrogation_Position=929; Antisense; AGAGAATGATCCACGGCCACGGGCA
>probe:Drosophila_2:1638185_at:705:525; Interrogation_Position=949; Antisense; GGGCAAACACATTCCGACTTCAGTG
>probe:Drosophila_2:1638185_at:709:147; Interrogation_Position=965; Antisense; ACTTCAGTGGTGTCGTTGCCTTTGC
>probe:Drosophila_2:1638185_at:248:469; Interrogation_Position=979; Antisense; GTTGCCTTTGCCACAGTCACTAGAT

Paste this into a BLAST search page for me
TGCCACTGTCAATGCCCCAAGGGATAAGGGATCGGCGACCAGCAGCGACCCGAGCAGTTGACCTGTTGTCTTTTTTGGCACTGGTGCTCAAACGAACATAAACTCTTGTCCGGAATCACAGTCGAATCACAGTCGATCGCAGAAGCCGCATAAATAGCCGTAATCCCTTCAATCCGTACTTTGCCTATAGTTTCTGCTGCTTCTGCTGCAGTTACGAAACGGCGGAACAGAGCCGCTGAACGTGGAGTTCAGAGAATGATCCACGGCCACGGGCAGGGCAAACACATTCCGACTTCAGTGACTTCAGTGGTGTCGTTGCCTTTGCGTTGCCTTTGCCACAGTCACTAGAT

Full Affymetrix probeset data:

Annotations for 1638185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720