Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638189_s_at:

>probe:Drosophila_2:1638189_s_at:9:397; Interrogation_Position=3435; Antisense; GAAATTATTGTAACTGCTCTGCTAC
>probe:Drosophila_2:1638189_s_at:6:195; Interrogation_Position=3446; Antisense; AACTGCTCTGCTACTAGGCTTAGGT
>probe:Drosophila_2:1638189_s_at:144:667; Interrogation_Position=3457; Antisense; TACTAGGCTTAGGTCGGCTATCTCC
>probe:Drosophila_2:1638189_s_at:193:571; Interrogation_Position=3472; Antisense; GGCTATCTCCTACAAACTATCCAAG
>probe:Drosophila_2:1638189_s_at:554:483; Interrogation_Position=3496; Antisense; GTATCTATCTATGCAAGTTTATGTT
>probe:Drosophila_2:1638189_s_at:102:33; Interrogation_Position=3523; Antisense; ATCGAATGCTTTATCTAGTAATCCA
>probe:Drosophila_2:1638189_s_at:598:661; Interrogation_Position=3579; Antisense; TAAACGGGCGCCAGACGACGAAGGA
>probe:Drosophila_2:1638189_s_at:342:175; Interrogation_Position=3662; Antisense; AAACCAAGCACATCCATACACATAA
>probe:Drosophila_2:1638189_s_at:79:181; Interrogation_Position=3685; Antisense; AAACACCACCATTGTACACACATAC
>probe:Drosophila_2:1638189_s_at:677:151; Interrogation_Position=3704; Antisense; ACATACACACACTAGCGCAAGCGAA
>probe:Drosophila_2:1638189_s_at:306:359; Interrogation_Position=3751; Antisense; GCAAAATCTGCTTTCAACTCATCTC
>probe:Drosophila_2:1638189_s_at:348:341; Interrogation_Position=3760; Antisense; GCTTTCAACTCATCTCATACTCATA
>probe:Drosophila_2:1638189_s_at:427:175; Interrogation_Position=3840; Antisense; AAACCATTAGACGAGGCAGCGAGAA
>probe:Drosophila_2:1638189_s_at:190:651; Interrogation_Position=3932; Antisense; TCACACTACACTCATGCACATTTTT

Paste this into a BLAST search page for me
GAAATTATTGTAACTGCTCTGCTACAACTGCTCTGCTACTAGGCTTAGGTTACTAGGCTTAGGTCGGCTATCTCCGGCTATCTCCTACAAACTATCCAAGGTATCTATCTATGCAAGTTTATGTTATCGAATGCTTTATCTAGTAATCCATAAACGGGCGCCAGACGACGAAGGAAAACCAAGCACATCCATACACATAAAAACACCACCATTGTACACACATACACATACACACACTAGCGCAAGCGAAGCAAAATCTGCTTTCAACTCATCTCGCTTTCAACTCATCTCATACTCATAAAACCATTAGACGAGGCAGCGAGAATCACACTACACTCATGCACATTTTT

Full Affymetrix probeset data:

Annotations for 1638189_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime