FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638190_at:

>probe:Drosophila_2:1638190_at:271:239; Interrogation_Position=311; Antisense; AATCAGATATCCTCATTGGGTGGCC
>probe:Drosophila_2:1638190_at:424:341; Interrogation_Position=348; Antisense; GCTATGGTCCCAAGATGTTCGATGC
>probe:Drosophila_2:1638190_at:491:613; Interrogation_Position=382; Antisense; TGAAGTTCCCGGCAATCGAGGCTAC
>probe:Drosophila_2:1638190_at:610:339; Interrogation_Position=402; Antisense; GCTACAAATACTTTGGAGCCGCCAA
>probe:Drosophila_2:1638190_at:363:633; Interrogation_Position=442; Antisense; TCGCGAGCTCTTTGAACAGGATCCT
>probe:Drosophila_2:1638190_at:229:215; Interrogation_Position=543; Antisense; AAGATGGTGTTCTGATCCCTCTGGA
>probe:Drosophila_2:1638190_at:263:563; Interrogation_Position=568; Antisense; GGAACGCATCGAACGAGCGGCCATT
>probe:Drosophila_2:1638190_at:82:395; Interrogation_Position=665; Antisense; GAAATATATCCCCTTTCGGGACCAG
>probe:Drosophila_2:1638190_at:335:555; Interrogation_Position=683; Antisense; GGACCAGCACGCGAAGCCATCGAGG
>probe:Drosophila_2:1638190_at:304:549; Interrogation_Position=730; Antisense; GGAGGATCCTCATGGCCTATTGGCA
>probe:Drosophila_2:1638190_at:249:719; Interrogation_Position=774; Antisense; TTCCCGTGCCGACGCAACAAGATGT
>probe:Drosophila_2:1638190_at:193:61; Interrogation_Position=795; Antisense; ATGTACAGGAAGCACTGCTGCGCCA
>probe:Drosophila_2:1638190_at:497:623; Interrogation_Position=813; Antisense; TGCGCCAGCGGAAACGGGAACTGCT
>probe:Drosophila_2:1638190_at:279:317; Interrogation_Position=848; Antisense; GCCGGTGGCACTAACTAAGCTCAAT

Paste this into a BLAST search page for me
AATCAGATATCCTCATTGGGTGGCCGCTATGGTCCCAAGATGTTCGATGCTGAAGTTCCCGGCAATCGAGGCTACGCTACAAATACTTTGGAGCCGCCAATCGCGAGCTCTTTGAACAGGATCCTAAGATGGTGTTCTGATCCCTCTGGAGGAACGCATCGAACGAGCGGCCATTGAAATATATCCCCTTTCGGGACCAGGGACCAGCACGCGAAGCCATCGAGGGGAGGATCCTCATGGCCTATTGGCATTCCCGTGCCGACGCAACAAGATGTATGTACAGGAAGCACTGCTGCGCCATGCGCCAGCGGAAACGGGAACTGCTGCCGGTGGCACTAACTAAGCTCAAT

Full Affymetrix probeset data:

Annotations for 1638190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720