FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638191_at:

>probe:Drosophila_2:1638191_at:121:353; Interrogation_Position=114; Antisense; GCAGCAGCTCCGTGAGCAACTGGAG
>probe:Drosophila_2:1638191_at:433:121; Interrogation_Position=140; Antisense; AGCGGCTATCGCAGGCAGGAGTCCA
>probe:Drosophila_2:1638191_at:674:605; Interrogation_Position=171; Antisense; TGATGAATTGTCTCGTTCCACGGAA
>probe:Drosophila_2:1638191_at:113:469; Interrogation_Position=185; Antisense; GTTCCACGGAATCAGATAGCGGCTT
>probe:Drosophila_2:1638191_at:323:27; Interrogation_Position=200; Antisense; ATAGCGGCTTTGACAGCAGCAGCAC
>probe:Drosophila_2:1638191_at:275:41; Interrogation_Position=282; Antisense; ATCGGGCAAGCCAGTGACAACTAAA
>probe:Drosophila_2:1638191_at:165:387; Interrogation_Position=297; Antisense; GACAACTAAACTAAGGGCACTCCCG
>probe:Drosophila_2:1638191_at:599:503; Interrogation_Position=376; Antisense; GTCCAGGCGGACGATGTTAACATTT
>probe:Drosophila_2:1638191_at:226:661; Interrogation_Position=393; Antisense; TAACATTTGGGCCTGCAAGTTCCTA
>probe:Drosophila_2:1638191_at:488:93; Interrogation_Position=410; Antisense; AGTTCCTACGTGATCTGGACAGCCT
>probe:Drosophila_2:1638191_at:354:607; Interrogation_Position=434; Antisense; TGATGGCCGCCGGTGATAAGCTGCC
>probe:Drosophila_2:1638191_at:195:155; Interrogation_Position=567; Antisense; ACAGAGTCGACTCGGCAAGGGCTCA
>probe:Drosophila_2:1638191_at:576:565; Interrogation_Position=580; Antisense; GGCAAGGGCTCATCATCCATCATGG
>probe:Drosophila_2:1638191_at:695:105; Interrogation_Position=635; Antisense; AGAACGGACTCGTCTTGAAACCAGA

Paste this into a BLAST search page for me
GCAGCAGCTCCGTGAGCAACTGGAGAGCGGCTATCGCAGGCAGGAGTCCATGATGAATTGTCTCGTTCCACGGAAGTTCCACGGAATCAGATAGCGGCTTATAGCGGCTTTGACAGCAGCAGCACATCGGGCAAGCCAGTGACAACTAAAGACAACTAAACTAAGGGCACTCCCGGTCCAGGCGGACGATGTTAACATTTTAACATTTGGGCCTGCAAGTTCCTAAGTTCCTACGTGATCTGGACAGCCTTGATGGCCGCCGGTGATAAGCTGCCACAGAGTCGACTCGGCAAGGGCTCAGGCAAGGGCTCATCATCCATCATGGAGAACGGACTCGTCTTGAAACCAGA

Full Affymetrix probeset data:

Annotations for 1638191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720