FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638194_at:

>probe:Drosophila_2:1638194_at:531:87; Interrogation_Position=317; Antisense; AGTCCATTGCTGCTCACTATTATCA
>probe:Drosophila_2:1638194_at:639:121; Interrogation_Position=385; Antisense; AGCGATTTCGCGGACATCAAGCGGA
>probe:Drosophila_2:1638194_at:470:329; Interrogation_Position=432; Antisense; GCTGGAGTTCACCAACTATCTGGGT
>probe:Drosophila_2:1638194_at:23:345; Interrogation_Position=486; Antisense; GCATTCGGTGGCAGGAGTGTTCAAA
>probe:Drosophila_2:1638194_at:158:83; Interrogation_Position=501; Antisense; AGTGTTCAAACCGTCCATTCTGAGC
>probe:Drosophila_2:1638194_at:335:353; Interrogation_Position=529; Antisense; GCAGCGGTCAACGAGCCAACAAAAG
>probe:Drosophila_2:1638194_at:326:257; Interrogation_Position=593; Antisense; CACAAACTGGCCTCCATGGAATGGT
>probe:Drosophila_2:1638194_at:393:433; Interrogation_Position=621; Antisense; GAGGGTCCTGGAAATTCTGCCGCAG
>probe:Drosophila_2:1638194_at:168:487; Interrogation_Position=654; Antisense; GTACGCCCTATTCTTCGACGAGTTT
>probe:Drosophila_2:1638194_at:506:471; Interrogation_Position=693; Antisense; GTTCGCAGCATTTGTCGACAGCATT
>probe:Drosophila_2:1638194_at:451:393; Interrogation_Position=766; Antisense; GAAATCCCGGGTCCACCATGTGGTA
>probe:Drosophila_2:1638194_at:205:527; Interrogation_Position=807; Antisense; GGGACACGCTTTGTTTGCTCGCTGG
>probe:Drosophila_2:1638194_at:109:143; Interrogation_Position=836; Antisense; ACTCCTACGGCTACGCGTATAGGTT
>probe:Drosophila_2:1638194_at:200:521; Interrogation_Position=867; Antisense; GGGCAACCTTTATATGCGATTCCGT

Paste this into a BLAST search page for me
AGTCCATTGCTGCTCACTATTATCAAGCGATTTCGCGGACATCAAGCGGAGCTGGAGTTCACCAACTATCTGGGTGCATTCGGTGGCAGGAGTGTTCAAAAGTGTTCAAACCGTCCATTCTGAGCGCAGCGGTCAACGAGCCAACAAAAGCACAAACTGGCCTCCATGGAATGGTGAGGGTCCTGGAAATTCTGCCGCAGGTACGCCCTATTCTTCGACGAGTTTGTTCGCAGCATTTGTCGACAGCATTGAAATCCCGGGTCCACCATGTGGTAGGGACACGCTTTGTTTGCTCGCTGGACTCCTACGGCTACGCGTATAGGTTGGGCAACCTTTATATGCGATTCCGT

Full Affymetrix probeset data:

Annotations for 1638194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720