FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638195_at:

>probe:Drosophila_2:1638195_at:212:125; Interrogation_Position=1482; Antisense; AGCGCCCATGGGTGACATCAACTAC
>probe:Drosophila_2:1638195_at:36:247; Interrogation_Position=1513; Antisense; AATTCCACCCATGCAGCTATATACG
>probe:Drosophila_2:1638195_at:653:511; Interrogation_Position=1560; Antisense; GTGTTTGTTTTTCTCCTGGATCGTC
>probe:Drosophila_2:1638195_at:322:451; Interrogation_Position=1578; Antisense; GATCGTCTTTGTCTCCCATAATGGA
>probe:Drosophila_2:1638195_at:348:193; Interrogation_Position=1613; Antisense; AACTGACGAAGCTGTTTGCCTGGCG
>probe:Drosophila_2:1638195_at:688:539; Interrogation_Position=1639; Antisense; GGTTTCCAGGTGTCCACGAAGCTAT
>probe:Drosophila_2:1638195_at:224:377; Interrogation_Position=1656; Antisense; GAAGCTATCGTATGCCATTTACCTG
>probe:Drosophila_2:1638195_at:435:513; Interrogation_Position=1693; Antisense; GTGTTCTTCTTTAATGTCGGCCGAA
>probe:Drosophila_2:1638195_at:25:365; Interrogation_Position=1771; Antisense; GAATTCATATCGATCTTCCTGGCCT
>probe:Drosophila_2:1638195_at:38:717; Interrogation_Position=1816; Antisense; TTCGATGCACCGTTCCAGAATCTAA
>probe:Drosophila_2:1638195_at:163:109; Interrogation_Position=1841; Antisense; AGAAGCTGCTGATCAAGCGACCCAC
>probe:Drosophila_2:1638195_at:453:543; Interrogation_Position=1986; Antisense; GGATTAGTCTGGATGCACACACTCT
>probe:Drosophila_2:1638195_at:536:357; Interrogation_Position=2000; Antisense; GCACACACTCTTTCTTAGCTATGTA
>probe:Drosophila_2:1638195_at:467:23; Interrogation_Position=2056; Antisense; ATATGTTTAGTGATCCCCAGCGAAA

Paste this into a BLAST search page for me
AGCGCCCATGGGTGACATCAACTACAATTCCACCCATGCAGCTATATACGGTGTTTGTTTTTCTCCTGGATCGTCGATCGTCTTTGTCTCCCATAATGGAAACTGACGAAGCTGTTTGCCTGGCGGGTTTCCAGGTGTCCACGAAGCTATGAAGCTATCGTATGCCATTTACCTGGTGTTCTTCTTTAATGTCGGCCGAAGAATTCATATCGATCTTCCTGGCCTTTCGATGCACCGTTCCAGAATCTAAAGAAGCTGCTGATCAAGCGACCCACGGATTAGTCTGGATGCACACACTCTGCACACACTCTTTCTTAGCTATGTAATATGTTTAGTGATCCCCAGCGAAA

Full Affymetrix probeset data:

Annotations for 1638195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720