FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638196_at:

>probe:Drosophila_2:1638196_at:158:199; Interrogation_Position=378; Antisense; AACGACATCGCTGTCATCCGTCTGA
>probe:Drosophila_2:1638196_at:358:499; Interrogation_Position=397; Antisense; GTCTGAGCTCTTCCCTGAGCTTCAG
>probe:Drosophila_2:1638196_at:456:343; Interrogation_Position=415; Antisense; GCTTCAGCTCAAGCATCAAGGCTAT
>probe:Drosophila_2:1638196_at:599:67; Interrogation_Position=433; Antisense; AGGCTATTAGCCTGGCCACTTACAA
>probe:Drosophila_2:1638196_at:400:579; Interrogation_Position=446; Antisense; GGCCACTTACAACCCAGCTAACGGA
>probe:Drosophila_2:1638196_at:556:115; Interrogation_Position=461; Antisense; AGCTAACGGAGCCTCTGCCGCCGTT
>probe:Drosophila_2:1638196_at:299:535; Interrogation_Position=495; Antisense; GGTACCCAGTCGTCCGGATCCAGCT
>probe:Drosophila_2:1638196_at:71:505; Interrogation_Position=765; Antisense; GTCCTCCGCTCTTGGGTGGTGAGCA
>probe:Drosophila_2:1638196_at:59:281; Interrogation_Position=773; Antisense; CTCTTGGGTGGTGAGCACTGCTAAC
>probe:Drosophila_2:1638196_at:128:535; Interrogation_Position=782; Antisense; GGTGAGCACTGCTAACAGCATCTAA
>probe:Drosophila_2:1638196_at:254:189; Interrogation_Position=795; Antisense; AACAGCATCTAAGCTGGTACCCAGT
>probe:Drosophila_2:1638196_at:357:117; Interrogation_Position=806; Antisense; AGCTGGTACCCAGTAGGTTGGATGT
>probe:Drosophila_2:1638196_at:141:539; Interrogation_Position=821; Antisense; GGTTGGATGTGTCAAAAGCCTTCAA
>probe:Drosophila_2:1638196_at:32:665; Interrogation_Position=846; Antisense; TAAATATTTGCCATTCAGAACATAG

Paste this into a BLAST search page for me
AACGACATCGCTGTCATCCGTCTGAGTCTGAGCTCTTCCCTGAGCTTCAGGCTTCAGCTCAAGCATCAAGGCTATAGGCTATTAGCCTGGCCACTTACAAGGCCACTTACAACCCAGCTAACGGAAGCTAACGGAGCCTCTGCCGCCGTTGGTACCCAGTCGTCCGGATCCAGCTGTCCTCCGCTCTTGGGTGGTGAGCACTCTTGGGTGGTGAGCACTGCTAACGGTGAGCACTGCTAACAGCATCTAAAACAGCATCTAAGCTGGTACCCAGTAGCTGGTACCCAGTAGGTTGGATGTGGTTGGATGTGTCAAAAGCCTTCAATAAATATTTGCCATTCAGAACATAG

Full Affymetrix probeset data:

Annotations for 1638196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720