FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638197_at:

>probe:Drosophila_2:1638197_at:120:323; Interrogation_Position=3089; Antisense; GCGCGGGCATCGAGAGTCAGTTCTA
>probe:Drosophila_2:1638197_at:318:59; Interrogation_Position=3113; Antisense; ATGATCTGCATCAAGTCGCATCCAC
>probe:Drosophila_2:1638197_at:664:11; Interrogation_Position=3148; Antisense; ATTCTGTTGCGAAGCACCGAGCGTG
>probe:Drosophila_2:1638197_at:357:417; Interrogation_Position=3166; Antisense; GAGCGTGCCGCCTGGATGGACTACC
>probe:Drosophila_2:1638197_at:116:441; Interrogation_Position=3180; Antisense; GATGGACTACCACAGCCGATGCATA
>probe:Drosophila_2:1638197_at:460:53; Interrogation_Position=3198; Antisense; ATGCATACAGTTCATGCGGCTCTTC
>probe:Drosophila_2:1638197_at:300:157; Interrogation_Position=3227; Antisense; ACACCGACGTCGAGGCAATGGGCAA
>probe:Drosophila_2:1638197_at:561:119; Interrogation_Position=3326; Antisense; AGCTGTGCCGCCGAATCGGAAGCGA
>probe:Drosophila_2:1638197_at:698:465; Interrogation_Position=3410; Antisense; GTTGGTACTTTGTTGGCACTTAGCA
>probe:Drosophila_2:1638197_at:138:357; Interrogation_Position=3425; Antisense; GCACTTAGCATTTATATCTTCTCTG
>probe:Drosophila_2:1638197_at:705:659; Interrogation_Position=3453; Antisense; TAACTGTTAATTGTTTGTGCCCGCC
>probe:Drosophila_2:1638197_at:439:299; Interrogation_Position=3505; Antisense; CGCCTGCATCACAAATCCATGGAGA
>probe:Drosophila_2:1638197_at:83:589; Interrogation_Position=3524; Antisense; TGGAGACACGCAACCAGCAACGCAA
>probe:Drosophila_2:1638197_at:308:667; Interrogation_Position=3625; Antisense; TACATCCCCGTTTCAGTTGCAACTG

Paste this into a BLAST search page for me
GCGCGGGCATCGAGAGTCAGTTCTAATGATCTGCATCAAGTCGCATCCACATTCTGTTGCGAAGCACCGAGCGTGGAGCGTGCCGCCTGGATGGACTACCGATGGACTACCACAGCCGATGCATAATGCATACAGTTCATGCGGCTCTTCACACCGACGTCGAGGCAATGGGCAAAGCTGTGCCGCCGAATCGGAAGCGAGTTGGTACTTTGTTGGCACTTAGCAGCACTTAGCATTTATATCTTCTCTGTAACTGTTAATTGTTTGTGCCCGCCCGCCTGCATCACAAATCCATGGAGATGGAGACACGCAACCAGCAACGCAATACATCCCCGTTTCAGTTGCAACTG

Full Affymetrix probeset data:

Annotations for 1638197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720