Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638198_at:

>probe:Drosophila_2:1638198_at:594:319; Interrogation_Position=1112; Antisense; GCCCCATTTGATCATCAATGCCAAC
>probe:Drosophila_2:1638198_at:591:197; Interrogation_Position=1137; Antisense; AACGAGCTTATTGACACCGACGCCG
>probe:Drosophila_2:1638198_at:638:409; Interrogation_Position=1197; Antisense; GACGACGACGTGACCGGACGCTGCT
>probe:Drosophila_2:1638198_at:152:569; Interrogation_Position=1260; Antisense; GGCAGACTTTCGGTCGGAAGCATTT
>probe:Drosophila_2:1638198_at:350:15; Interrogation_Position=1281; Antisense; ATTTATATCGGTGACGGTGGCGACT
>probe:Drosophila_2:1638198_at:519:673; Interrogation_Position=1352; Antisense; TACCTCCAGAGAACTGCTCTACATG
>probe:Drosophila_2:1638198_at:661:611; Interrogation_Position=1375; Antisense; TGAAATTCGGTGACTTTCTGGCCGC
>probe:Drosophila_2:1638198_at:119:581; Interrogation_Position=1393; Antisense; TGGCCGCCAGATTGAACACTTTGCA
>probe:Drosophila_2:1638198_at:627:187; Interrogation_Position=1407; Antisense; AACACTTTGCATGAGACTGTAGCTA
>probe:Drosophila_2:1638198_at:329:411; Interrogation_Position=1486; Antisense; GACCGATGTCGCCTCTAAAATTATT
>probe:Drosophila_2:1638198_at:665:705; Interrogation_Position=1515; Antisense; TTAGAGTTGCGTAAGCTCCCATCAC
>probe:Drosophila_2:1638198_at:667:33; Interrogation_Position=1535; Antisense; ATCACCAAGGCGACATCGTGTTAGA
>probe:Drosophila_2:1638198_at:349:535; Interrogation_Position=1571; Antisense; GGTGCACAAATCAAGTCTGTTCAAT
>probe:Drosophila_2:1638198_at:351:273; Interrogation_Position=1600; Antisense; CATTTAAGCATCTCTCTAAGGCGTA

Paste this into a BLAST search page for me
GCCCCATTTGATCATCAATGCCAACAACGAGCTTATTGACACCGACGCCGGACGACGACGTGACCGGACGCTGCTGGCAGACTTTCGGTCGGAAGCATTTATTTATATCGGTGACGGTGGCGACTTACCTCCAGAGAACTGCTCTACATGTGAAATTCGGTGACTTTCTGGCCGCTGGCCGCCAGATTGAACACTTTGCAAACACTTTGCATGAGACTGTAGCTAGACCGATGTCGCCTCTAAAATTATTTTAGAGTTGCGTAAGCTCCCATCACATCACCAAGGCGACATCGTGTTAGAGGTGCACAAATCAAGTCTGTTCAATCATTTAAGCATCTCTCTAAGGCGTA

Full Affymetrix probeset data:

Annotations for 1638198_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime